Regulation of nuclear division during mitotic stagnation

... REGULATION OF NUCLEAR DIVISION DURING MITOTIC STAGNATION ZHANG TAO (M.B.B.S., M.Med., GUANGXI MEDICAL UNIVERSITY) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY INSTITUTE OF MOLECULAR ... chromosome segregation… Nuclear division in slk19Δcells…………………………… Partial nuclear division in slk19Δ cells occurs prior to initiation of anaphase…………………………………… … Par...

Ngày tải lên: 14/09/2015, 14:25

... by the change to a myofibroblastoid morphology (Fig 1A) After 20 days of TGF-β administration, the cells represent activated MFBs with a stable phenotype, termed M-HTs Transdifferentiation of ... collagen synthesis in human hepatic stellate cells: role of nitric oxide Hepatology 1997, 25:361-367 Murrell GA, Francis MJ, Bromley L: Modulation of fibroblast proliferation b...

Ngày tải lên: 13/08/2014, 13:20

... to the presence of a conserved 43-amino acid Cap’n’Collar (CnC) domain at the Nterminus of the Nrf2 DNA binding domain (Figure 1.1) The name Nuclear factor erythroid- 2 (NF-E2) -related factor 2 ... factor erythroid- 2 NF- κB Nuclear Factor- kappaB Nrf2 Nuclear factor erythroid- 2 (NF-E2) -related factor Nqo1 NAD(P)H:quinine oxidoreductase   xii     PKC...

Ngày tải lên: 09/09/2015, 08:16

... Evolution of the nucleus and its constituents One of the striking differences between eukaryotes and prokaryotes is the presence of the nucleus isolating the nuclear genome from the rest of the ... mitosis positioned at the opposite ends of the spectrum In the closed mitosis, the nuclear envelope remains intact throughout the nuclear division Altern...

Ngày tải lên: 10/09/2015, 09:10

... mechanisms of regulation of folate malabsorption during chronic alcoholism Under chronic alcoholic conditions, the kinetic constants of the folate transport process in intestinal brush border membrane ... the intestinal membrane [12,20] In a rat model of experimental alcoholism, we examined the mechanism of the regulation of folate transport mediated...

Ngày tải lên: 18/02/2014, 16:20

... suppression of respiration during hypoxia In the absence of differential regulation of a speci c nuclear gene coding for the subunits of CytOX, changes in the microenvironment of the cell may induce alterations ... modulates the expression of mRNAs for CytOX subunits and also the catalytic activity of the enzyme complex Our results show tha...

Ngày tải lên: 20/02/2014, 23:20

... 2675 Actin and ABPs in transcription regulation B Zheng et al Table Role of nuclear actin- binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain ... STARS-interacting proteins These novel proteins contain four LIM domains and a C-terminal villin headpiece domain, which mediates actin- binding in several proteins,...

Ngày tải lên: 07/03/2014, 01:20

... 2,5-dibromo-3-methyl-6-isopropyl-p-bezochinon Why the photosynthetic green algae still keep the anaerobically induced hydrogenases? The most likely explanation is that the enzymes ensure the survival of the cells under these ... Val-Ala-Cys-Ala (Fig 2) In addition to the detection of the protein using antibodies raised against the Fe-hydrogenase, the localization...

Ngày tải lên: 08/03/2014, 22:20

... and dbcAMP upregulated the syndecan-1 and syndecan-4 mRNA expression in 30-days-old rat Sertoli cells (Tables and 3) Indeed, FSH increased syndecan-1 and syndecan-4 mRNAs expression by +40 and ... effects of increased intracellular cAMP and intracellular calcium levels Moreover, calcium induces no effect on glypican-1 and syndecan-1 mRNAs express...

Ngày tải lên: 17/03/2014, 23:20

... These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate that Sp1 and Sp3 play a pivotal role in the transcriptional ... and Sp3 are able to bind to the GC boxes and that binding of Sp1 forms complex C1 and binding of Sp3 forms complexes C2 and C3 PMA treatment increa...

Ngày tải lên: 23/03/2014, 17:21

... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...

Ngày tải lên: 29/03/2014, 21:20

... interaction with inhibitor of nuclear factor- kappaB alpha (IjBa) or p105 [the precursor of p50 nuclear factor- kappaB (NF-jB)] was discovered before its interactions with ASB4 and Notch-1 By using yeast ... an NF-jB inhibitor, IjBa, activated HIF -1a by sequestering an HIF -1a inhibitor, FIH During inflammation, IjBa is phosphorylated at Ser32 and Ser36 by IkB...

Ngày tải lên: 29/03/2014, 23:20

... except of DNA polymerase b-like, are inhibited by PMLA contained in the extracts The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in the presence ... mitosis Thus, the in vivo and in vitro activities of DNA synthesis corresponded with the minimum of the inhibitory activity in the cel...

Ngày tải lên: 31/03/2014, 21:21

... hypoxia-induced NFκB activity The fact that the inhibitory action of hydroxylases is at the level of the IKK complex through suppression of catalytic activity means that microenvironmental hypoxia ... immunity and the hypoxic response through studies involving the depletion of a component of the NFκB signalling pathway Using mice lacking IKKβ (the key catalytic...

Ngày tải lên: 09/08/2014, 01:22