Paired end tags for unravelling genomic elements and chromantin interactions
Paired end tags for unravelling genomic elements and chromantin interactions
... Identification Signature with Paired- End Tags DNA-PET Genomic DNA analysis with Paired- End Tags GSC-PET Gene Scanning CAGE with Paired- End Tags GST Genomic Signature Tags iPET Inter-ligation PET ... Polyadenylation Site PCR Polymerase Chain Reaction PE-GST Paired End Genomic Signature Tags PEM Paired End Mapping PES Paired End Sequencing PET Paired- E...
Ngày tải lên: 14/09/2015, 14:13
Paired end transcriptome assembly and genomic variants management for next generation sequencing data
... PETA and UASIS, to interpret and analyze large scale of Next Generation Sequencing data They serve as fundamental components to provide accurate transcriptomes and better data management for related ... PETA (Paired End Transcriptome Assembler) We claim that the full utilization of raw reads and paired- end information is able to construct a cleaner splicing grap...
Ngày tải lên: 01/10/2015, 17:28
Family of Uniform Strain Tetrahedral Elements and a Method for Connecting Dissimilar Finite Element Meshes ppt
... standard uniform strain approach for the quadrilateral and hexahedron in conjunction with a set of kinematic constraints Specification of the constraints allows surface loads to be varied in a ... tetrahedra into four hexahedra Within each of the quadrilateral or hexahedral domains, the element formulations are based on the standard uniform strain approach [2] Element...
Ngày tải lên: 27/06/2014, 14:20
Báo cáo y học: "Receptor for advanced glycation end products Glycine 82 Serine polymorphism and risk of cardiovascular events in rheumatoid arthritis" potx
... amyloid and advanced glycation end products (AGEs) [15] AGEs are the products of nonenzymatic glycation and oxidation of proteins that form with aging, diabetes and renal failure, and at sites of inflammation ... and colleagues recently demonstrated 10% mortality, predominantly owing to CV events, within 10 years of onset of inflammatory polyarthritis [27] In...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "ChIA-PET tool for comprehensive chromatin interaction analysis with paired-end tag sequencing" potx
... 10.1186/gb-2010-11-2-r22 Cite this article as: Li et al., ChIA-PET tool for comprehensive chromatin interaction analysis with paired-end tag sequencing Genome Biology 2010, 11:R22 ... capture-on-chip (4C) Nat Genet 2006, 38:1348-1354 18 ChIA-PET Tool for Comprehensive Chromatin Interaction Analysis with Paired-End Tag Sequencing [http://chiapet.gis.a-star.e...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf
... of each primer (forward, TMPRSS2 exon - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al [23]) and 50 ng cDNA at an annealing temperature (Ta) ... statistical significance are mandatory FusionSeq: a modular framework In the current study, we describe FusionSeq, a novel computational and statistical framework to identify fusion tran...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "Targeted genomic capture and massively parallel sequencing to identify genes for hereditary hearing loss in middle eastern families" pot
... Targeted genomic capture and massively parallel sequencing to identify genes for hereditary hearing loss in middle eastern families Genome Biology 2011 12:R89 • Inclusion in PubMed, CAS, Scopus and ... study was to apply DNA capture and MPS to identify inherited mutations involved in hearing loss We designed oligonucleotides to capture t...
Ngày tải lên: 09/08/2014, 23:20
báo cáo khoa học: " Genetics of childhood and adolescent depression: insights into etiological heterogeneity and challenges for future genomic research" pot
... doi:10.1186/gm189 Cite this article as: Rice F: Genetics of childhood and adolescent depression: insights into etiological heterogeneity and challenges for future genomic research Genome Medicine 2010, ... that compare risk factors for childhood/ adolescent and adult depression, as well as from studies examining rates of familial aggregation and contin...
Ngày tải lên: 11/08/2014, 12:20
BARRIER SYSTEMS for ENVIRONMENTAL CONTAMINANT CONTAINMENT and TREATMENT - PART 5 (end) ppsx
... 6 15 620 630 640 Cell 6 45 650 Southern extent of final cover system construction 6 05 610 6 15 620 6 25 630 6 35 640 6 45 650 655 660 6 65 670 670 6 65 660 655 650 6 45 640 6 35 630 6 25 620 610 FIGURE 5. 8 ... 4040_C0 05. fm Page 302 Wednesday, September 21, 20 05 12:28 PM 302 Barrier Systems for Environmental Contaminant Containment & Treatment 5. 5.2.1 Long-Ter...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo sinh học: "WordCluster: detecting clusters of DNA words and genomic elements" docx
... http://www.almob.org/content/6/1/2 clusters of CpGs (CpG islands) using different distance models, 2) detection of clusters of the word CWG (where W = A, T) and 3) detection of clusters of olfactory receptor ... percentage of methylated words (CAG and CTG) inside and outside of the clusters We observed that 26.7% of all CAG/CTG trinucleotides are methylated ins...
Ngày tải lên: 12/08/2014, 17:20
IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY
... all of their love and support throughout the years iii ABSTRACT Sarah C Shuck Identification of novel small molecule inhibitors of proteins required for genomic maintenance and stability Targeting ... (51) 1.5 Inhibition of Proteins Required for Genomic Maintenance and Stability As described in previous sections, maintaining genomic stability...
Ngày tải lên: 24/08/2014, 11:28
End effect, stopping criterion, mode mixing and confidence limit for the hilbert huang transform
... End- effect, stopping criterion, mode mixing and confidence limit for the Hilbert- Huang transform JULIEN RÉMY DOMINIQUE GÉRARD LANDEL (Eng Deg., ÉCOLE POLYTECHNIQUE) A THESIS SUBMITTED FOR THE ... of the algorithm are described and the concept of confidence limit for the HHT is presented Finally, the implementation of the HHT algorithm is detai...
Ngày tải lên: 05/10/2015, 21:23