Investigation of the roles of two rac1 effectors phosphatidylinositol 5 kinase 1a and p21 activated kinase 1 in insulin secreting cells

Investigation of the roles of two rac1 effectors phosphatidylinositol 5 kinase 1a and p21 activated kinase 1 in insulin secreting cells

Investigation of the roles of two rac1 effectors phosphatidylinositol 5 kinase 1a and p21 activated kinase 1 in insulin secreting cells

... INVESTIGATION OF THE ROLES OF TWO RAC1 EFFECTORS PHOSPHATIDYLINOSITOL- 5 KINASE Iα AND P 21- ACTIVATED KINASE IN INSULINSECRETING CELLS ZHANG JIPING (B.Sc., SICHUAN University) A THESIS SUBMITTED ... PIP5K-Iα in insulin secretion in INS -1 cells 11 1 4 .1. 3 Implication of PIP5K-Iα in PIP2 production in INS -1 cells 1 15 4 .1. 4 Role of...

Ngày tải lên: 14/09/2015, 14:08

182 278 0
ROLES OF HUNTINGTIN ASSOCIATED PROTEIN 1 IN INSULIN SECRETING CELLS

ROLES OF HUNTINGTIN ASSOCIATED PROTEIN 1 IN INSULIN SECRETING CELLS

... INTRODUCTION 1. 1 β-cell and insulin secretion 1. 1 .1 Diabetes mellitus 1. 1.2 Insulin 1. 1.3 Insulin secretion 1. 1.4 insulin- secreting cell model 1. 1.5 β-cell growth and cell cycle 1. 2 HAP1 10 1. 2 .1 HAP1 background ... of HAP1 in insulin- secreting cells after knockdown of its expression in INS -1 cell line The findings of HAP1 role in INS -1 cel...

Ngày tải lên: 12/10/2015, 17:35

97 235 0
Investigation into the roles of ataxia telangiectasia mutated gene product, in multiple BRCA backgrounds

Investigation into the roles of ataxia telangiectasia mutated gene product, in multiple BRCA backgrounds

... INVESTIGATION INTO THE ROLES OF ATAXIA TELANGIECTASIA MUTATED GENE PRODUCT, IN MULTIPLE BRCA BACKGROUNDS HIONG KUM CHEW (B.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE ... investigate the contribution of simultaneous loss of ATM and BRCA function in multiple cell culture based models We utilized various approaches to investigat...

Ngày tải lên: 08/11/2015, 17:00

100 257 0
báo cáo khoa học: " Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii" pdf

báo cáo khoa học: " Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii" pdf

... obvious in the plastid genome of C reflexa and the parasitic lifestyle of this plant is therefore not obvious from the structure and coding capacity of the plastid genome Analysis of plastid gene ... intron of clpP in Cuscuta gronovii Splicing Splicing of the intron of clpP in Cuscuta gronovii A: PCR (DNA) and RT-PCR (cDNA) products of clpP over...

Ngày tải lên: 12/08/2014, 05:20

12 203 0
Báo cáo y học: "Understanding the roles of the transcription factors nuclear κ α factor-κB and hypoxia-inducible factor-1α in lung injury" pptx

Báo cáo y học: "Understanding the roles of the transcription factors nuclear κ α factor-κB and hypoxia-inducible factor-1α in lung injury" pptx

... translocation and increases IκB -α expression in κ α A549 cells J Clin Invest, 99:2423-2428 Lentsch AB, Shanley TP, Sarma V, Ward PA: In vitro suppresκ κ α sion of NF-κB and preservation of IκB -α by interleukin-13 ... consists of two subunits HIF- 1α, a DNAbinding protein, has increased stability and binding in hypoxic conditions and is degraded rapidly in nor...

Ngày tải lên: 12/08/2014, 19:21

2 193 0
Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

... compare these two models for appropriate modeling and prediction of heavy metal toxicity and accumulation Funaria hygrometrica Hedw is one of the most tolerant mosses to heavy metals (Itouga ... prediction of heavy metal toxicity and accumulation in organisms CONCLUSIONS Two BLMs predicting copper toxicity and copper accumulation in F hygr...

Ngày tải lên: 05/09/2013, 10:15

7 432 0
Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

... tissue, (insets) CsA-treated Fabry (A, B) Heart – endothelial staining in Fabry mouse; (C, D) lung – epithelial cell staining increased in Fabry mouse; (E, F) brain microvascular endothelial staining ... Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al (2002) Production in yeast of alpha-galactosidase A, a...

Ngày tải lên: 19/02/2014, 07:20

12 432 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the...

Ngày tải lên: 07/03/2014, 21:20

20 432 0
Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

... regulators in S coelicolor Fig Comparative alignment of domains (DNA–protein interaction), (dimerization and metal binding) and (containing a nonconserved amino acid stretch), of the Streptomyces coelicolor ... on DNAÆprotein interaction and of domain in the protein dimerization and metal binding (see the Discussion) There are important differences between DmdR1 and...

Ngày tải lên: 16/03/2014, 18:20

11 315 0
Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

... assays of antifreeze activity against culture media of a total of 23 species of ascomycetes, and identified and purified AFP from an ascomycete collected in Antarctica (AnpAFP) We believe that comparison ... consists of approximately 10 isoforms Here, AnpAFP, TisAFP and AFPIII (Fig 5) consist of a mixture of AFP isoforms in A psychrotrophicus, Typhula ishikariensis...

Ngày tải lên: 22/03/2014, 21:20

10 433 0
Normalization of two-channel microarrays accounting for experimental design and intensity-dependent relationships pot

Normalization of two-channel microarrays accounting for experimental design and intensity-dependent relationships pot

... dye-swap design can be characterized by a standard design matrix Z with rows for each array channel and columns for the comparison groups, dyes, and arrays Specifically, with n arrays and p comparison ... groups The fANOVA model and its basis matrix representation allow for flexible choices of the form of its component functions, as well as for the inclusion of addit...

Ngày tải lên: 29/03/2014, 14:20

11 814 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

... cyclooxygenase pathway PGE2 is the major prostanoid synthesized by lung fibroblasts [11] It can also act on fibroblasts in a paracrine fashion after release from the adjacent epithelial layer [12] In addition ... differential modulation of the translation rate or the rate of internalization and degradation of PAR-1 protein As we and others [15–17,26,33] h...

Ngày tải lên: 30/03/2014, 04:20

11 338 0
báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx

báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx

... given to the subject to help with the timing of the pushbutton activation during the patient-controlled conditions This was done by using verbal cues (eg "now", "now") to help them find an appropriate ... subjects with incomplete spinal cord injury walking at 0.54 m/s wearing the orthoses powered under pushbutton control by a therapist (therapist-controlled or...

Ngày tải lên: 19/06/2014, 10:20

17 450 0
Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

... project The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/05VIE) in Vietnam ... GRRC in the north This aim is reflected in the project title The improvement and implementation of new appropriate technologies...

Ngày tải lên: 21/06/2014, 06:20

12 542 0
Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

... 1 Institute Information Project Name The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of ... improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder incom...

Ngày tải lên: 21/06/2014, 06:20

13 659 0
w