Investigation of the roles of two rac1 effectors phosphatidylinositol 5 kinase 1a and p21 activated kinase 1 in insulin secreting cells

... INVESTIGATION OF THE ROLES OF TWO RAC1 EFFECTORS PHOSPHATIDYLINOSITOL- 5 KINASE Iα AND P 21- ACTIVATED KINASE IN INSULINSECRETING CELLS ZHANG JIPING (B.Sc., SICHUAN University) A THESIS SUBMITTED ... PIP5K-Iα in insulin secretion in INS -1 cells 11 1 4 .1. 3 Implication of PIP5K-Iα in PIP2 production in INS -1 cells 1 15 4 .1. 4 Role of PIP5K-Iα in glucose metabolism and membrane potential 11 8 ... .10 7 4 .1 Roles of PIP5K-Iα in insulin- secreting cells 10 9 4 .1. 1 Involvement of PIP5K-Iα in cell morphology and actin cytoskeleton organization in INS -1 cells 11 0 4 .1. 2 Role of...

ROLES OF HUNTINGTIN ASSOCIATED PROTEIN 1 IN INSULIN SECRETING CELLS

... INTRODUCTION 1. 1 β-cell and insulin secretion 1. 1 .1 Diabetes mellitus 1. 1.2 Insulin 1. 1.3 Insulin secretion 1. 1.4 insulin- secreting cell model 1. 1.5 β-cell growth and cell cycle 1. 2 HAP1 10 1. 2 .1 HAP1 background ... of HAP1 in insulin- secreting cells after knockdown of its expression in INS -1 cell line The findings of HAP1 role in INS -1 cell may shed light on the understanding of complicated signaling pathways ... List of Figures Figure The classic signaling pathway for insulin secretion from β -cells Figure Knockdown of HAP1 in INS -1 cells 48 Figure Effects of HAP1 knockdown in INS -1 cell on insulin secretion...

Investigation into the roles of ataxia telangiectasia mutated gene product, in multiple BRCA backgrounds

... INVESTIGATION INTO THE ROLES OF ATAXIA TELANGIECTASIA MUTATED GENE PRODUCT, IN MULTIPLE BRCA BACKGROUNDS HIONG KUM CHEW (B.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE ... investigate the contribution of simultaneous loss of ATM and BRCA function in multiple cell culture based models We utilized various approaches to investigate the role of ATM in multiple BRCA backgrounds ... various BRCA backgrounds exhibited differential sensitivity and survival responses Assessment of the expression profile of the knockdown and control cells using a PCR array of 84 genes involved in the...

báo cáo khoa học: " Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii" pdf

... obvious in the plastid genome of C reflexa and the parasitic lifestyle of this plant is therefore not obvious from the structure and coding capacity of the plastid genome Analysis of plastid gene ... intron of clpP in Cuscuta gronovii Splicing Splicing of the intron of clpP in Cuscuta gronovii A: PCR (DNA) and RT-PCR (cDNA) products of clpP overlapping the intron B: DNA and cDNA sequences of the ... genome and parts of the C reflexa plastid genome, annotated the C reflexa and C gronovii plastid genomes, performed the RT-PCR analysis of transcripts (including the identification of splicing and...

Báo cáo y học: "Understanding the roles of the transcription factors nuclear κ α factor-κB and hypoxia-inducible factor-1α in lung injury" pptx

... translocation and increases IκB -α expression in κ α A549 cells J Clin Invest, 99:2423-2428 Lentsch AB, Shanley TP, Sarma V, Ward PA: In vitro suppresκ κ α sion of NF-κB and preservation of IκB -α by interleukin-13 ... consists of two subunits HIF- 1α, a DNAbinding protein, has increased stability and binding in hypoxic conditions and is degraded rapidly in normoxia The accumulation of the α- subunits allows for α ... review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated α lung injury: role for hypoxia-inducible factor- 1α Crit Care 2003, 7 :in press Fein AM, Calalang-Colucci...

Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

... compare these two models for appropriate modeling and prediction of heavy metal toxicity and accumulation Funaria hygrometrica Hedw is one of the most tolerant mosses to heavy metals (Itouga ... prediction of heavy metal toxicity and accumulation in organisms CONCLUSIONS Two BLMs predicting copper toxicity and copper accumulation in F hygrometrica were developed to investigate the relationship ... by binding to a binding site other than BL In addition, changes in the conformation of BL caused by this binding of proton result in decreases in the number of BL The conformation change of BL...

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

... tissue, (insets) CsA-treated Fabry (A, B) Heart – endothelial staining in Fabry mouse; (C, D) lung – epithelial cell staining increased in Fabry mouse; (E, F) brain microvascular endothelial staining ... Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al (2002) Production in yeast of alpha-galactosidase A, a lysosomal enzyme applicable ... inhibition of MDR1 as an approach to the treatment of Fabry disease Although the efﬁcacy may not, as yet, be as dramatic as ERT, inhibition of MDR1 may prove most beneﬁcial as an adjunct, rather than alternative...

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the consensus retinoic acid X responsive ... AGGTACCGCTGCAGTGAGCCTTGATTG -3 , nucleotides )276 to )257) Prm3abb; pGL3b:Prm3abb (Primer Kin212, 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA -3 , nucleotides )229 to )209) Prm3abc; pGL3b:Prm3abc (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 ,...

Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

... regulators in S coelicolor Fig Comparative alignment of domains (DNA–protein interaction), (dimerization and metal binding) and (containing a nonconserved amino acid stretch), of the Streptomyces coelicolor ... on DNAÆprotein interaction and of domain in the protein dimerization and metal binding (see the Discussion) There are important differences between DmdR1 and DmdR2 proteins in a Pro- and Ala-rich ... existence, in S coelicolor, of a gene(s) encoding an iron-regulator of the DmdR family We report, in this article, the presence of two different genes – dmdR1 and dmdR2 – in the genome of S coelicolor, ...

Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

... assays of antifreeze activity against culture media of a total of 23 species of ascomycetes, and identiﬁed and puriﬁed AFP from an ascomycete collected in Antarctica (AnpAFP) We believe that comparison ... consists of approximately 10 isoforms Here, AnpAFP, TisAFP and AFPIII (Fig 5) consist of a mixture of AFP isoforms in A psychrotrophicus, Typhula ishikariensis and Zoarces elongatus, respectively ... 1, and found that only two ascomycete species, A psychrotrophicus and P camemberti, had antifreeze activities in the culture media The A psychrotrophicus strains were isolated from the soils of...

Normalization of two-channel microarrays accounting for experimental design and intensity-dependent relationships pot

... dye-swap design can be characterized by a standard design matrix Z with rows for each array channel and columns for the comparison groups, dyes, and arrays Specifically, with n arrays and p comparison ... groups The fANOVA model and its basis matrix representation allow for flexible choices of the form of its component functions, as well as for the inclusion of additional sources of bias The dye functions ... channel normalization, models of variations and assessment of gene effects Nucleic Acids Res 2001, 29:2540-2557 Yang YH, Dudoit S, Luu P, Speed TP: Normalization of cDNA microarrays In Microarrays: ...

Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung ﬁbroblasts is speciﬁcally mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

... cyclooxygenase pathway PGE2 is the major prostanoid synthesized by lung ﬁbroblasts [11] It can also act on ﬁbroblasts in a paracrine fashion after release from the adjacent epithelial layer [12] In addition ... differential modulation of the translation rate or the rate of internalization and degradation of PAR-1 protein As we and others [15–17,26,33] have shown the role of cAMP in the suppression of ﬁbroblast ... ﬁbrotic gingiva: interactions between cAMP and MAPK signaling pathways, and prostaglandin E2- EP3 receptor mediated activation of the c-JUN N-terminal kinase J Biol Chem 282, 15416–15429 27 Kamio...

báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx

... given to the subject to help with the timing of the pushbutton activation during the patient-controlled conditions This was done by using verbal cues (eg "now", "now") to help them find an appropriate ... subjects with incomplete spinal cord injury walking at 0.54 m/s wearing the orthoses powered under pushbutton control by a therapist (therapist-controlled orthoses) and powered under pushbutton control ... kinematics of two subjects with incomplete spinal cord injury who walked wearing orthoses powered under pushbutton control by a therapist (TC) and wearing orthoses powered under pushbutton control...

Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

... project The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/05VIE) in Vietnam ... GRRC in the north This aim is reflected in the project title The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in ... 1 Institute Information Project Number & Name Vietnamese Institution The development and implementation of new appropriate technologies for improving goat production and increasing small-holder...

Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

... 1 Institute Information Project Name The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of ... improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/05VIE) in Vietnam during the period ... The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam This is a program which includes...

Xem thêm

Từ khóa: apos fold changes of gene expression apos are correlated with gc3 and gcg genes specifically expressed in different developmental stages bear different molecular features manufacturer s instructions total rna 2µg from caudal neural tubes of embryos was added with 1µl of dntp mix 10mm 1µl of oligo dt primer 0 5µg µl and depc treated diagnosis 1 in 50 babies are born with serious physical or mental handicap and as many as 1 in 30 with some form of congenital malformation harper 1998 these may be due to structural or chromosomal abnormalities or single gene the groups should generate as many words related to birthday and birthday parties as possible in five minutes fill border 3d rotation etc using various tools from the format ribbon there are also tools for aligning layering and sizing your shape as in a desktop publishing programme lvh the precordial leads don apos t meet the usual voltage criteria or exhibit significant st segment abnormalities the frontal plane leads however show voltage criteria for lvh and significant st segment depression in leads with tal so what are the roles of the two isoforms in the mapk erk pnt inr axis here my preliminary data from s2 cells revealed that knockdown pntp2 brought down inr transcript level and meanwhile elevated pntp1 mrna whereas depleting pntp1 did not make identify and discuss the roles of mass communication in national development what are the roles of a catalyst and activation energy in a chemical reaction the sum of two cubes rule the sum of two cubes calculator the sum of two cubes in two different ways the roles of nigerian financial system in banking sector tale of two cities the fire rises factoring the sum or difference of two cubes calculator Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP