Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2
... comparison of the growth of Ge nanocrystals in silicon oxide and HfAlO matrices - 1 02 - Chapter 5 .2 Results & Discussions II Ge nanocrystals in HfAlO matrix In order to synthesize the Ge nanocrystals in ... almost insoluble in silicon oxide [20 ,21 ], whereas it has been found that thermal processing of HfO + Ge systems can lead to the formation of hafnium germ...
Ngày tải lên: 14/09/2015, 14:04
... 4 .10 : XTEM image of Sample B annealed at 10 00°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4 .11 : XTEM image of Sample C annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes ... image of Sample A annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4.3: XTEM image of Sample A annealed at 900°C in forming gas (10 % H2 + 90...
Ngày tải lên: 14/09/2015, 14:04
... annealed for 15 inset is the typical Raman spectra of as-grown and Ge nanocrystals nanocrystals of annealing minutes The free standing As mentioned in Section 4 .3, Figures 4.8 and 4.11 show that, ... a tensile stress will result in an increase in the lattice spacing and, hence, a decrease in the wavenumber of the vibrational mode In the case of compressive stress,...
Ngày tải lên: 14/09/2015, 14:04
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4
... competing factors which will influence the stress state of the nanocrystals in dielectrics, one is the capping effect and the other is temperature-dependent intrinsic tensile strain of SiN film ... atoms and therefore the growth of the nanocrystals In addition, it is interesting to note from the inset of Figure 7.1 (e), unlike the nanocrystals of the RTA sample shown...
Ngày tải lên: 14/09/2015, 14:04
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5
... discussed in the following sections 8.4 Synthesis of Ge nanocrystals in U-shape groove In order to minimize the shadowing effect and make a relatively conformal film deposition, the KOH etching process ... bottom of the groove (i.e 70.6°) as comparing to the one of the corner of the mesa (i.e 144.7°) This difference in the arriving angle will inevitably cause the shadowi...
Ngày tải lên: 14/09/2015, 14:04
Báo cáo hóa học: " Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics" doc
... nanocrystalline silicon embedded in SiO2 matrix Appl Phys Lett 1999, 75:1857-1859 Ding L, Chen TP, Liu Y, Ng CY, Fung S: Optical properties of silicon nanocrystals embedded in a SiO2 matrix Phys ... doi:10.1186/1556-276X-6-612 Cite this article as: Di et al.: Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo nghiên cứu nông nghiệp " Design and implementation and scientific and financial analysis of 12 Sunflower trials in Vietnam " pot
... crop season Sunflower was grown in the Autumn and compared to the financial benefit of maize in Di Linh district, Lam Dong province Crop Table 27 Economic analysis of sunflower, maize, in Autumn ... Study of the financial return of sunflower compared to maize and cotton in the South Central Coast of Viet Nam 2.3.1 Vegetative growth and development of sunf...
Ngày tải lên: 22/06/2014, 13:20
báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx
... stress and target genes were predicted for five of them For instance, vun_cand030 was downregulated by drought and putatively targets a zinc finger protein Zinc finger proteins are known to be involved ... breeding line developed by the International Institute of Tropical Page of 11 Agriculture (IITA) in Ibadan, Nigeria We grew these two genotypes in well-watered and drought...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: " A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia" ppsx
... Cite this article as: Neelam et al.: A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia BMC Psychiatry 2011 11:139 Submit your next manuscript ... Janssen J, Diaz-Caneja A, Reig S, Bombin I, Mayoral M, Parellada M, Graell M, Moreno D, Zabala A, Vazquez VG, Desco M, Arango C: Brain morphology and neurologi...
Ngày tải lên: 11/08/2014, 15:22
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps
... expression analysis for diurnally regulated genes To gain insights into the tissue specificity of expression levels of diurnally regulated genes, we next examined their expression levels in the ... studies By identifying a large number of diurnally regulated genes in a defined brain region, a clustering analysis resulted in sufficiently large number...
Ngày tải lên: 14/08/2014, 08:20
Structural and functional analysis of critical proteins involved in mRNA decay
... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and f...
Ngày tải lên: 14/09/2015, 22:22
báo cáo khoa học: " Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality" pot
... Cite this article as: Worch et al.: Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality BMC Plant Biology 2011 11:1 ... 4d drought (M) Palea_ 4d drought (M) Awn_ 4d drought (M) Seed_ 4d drought (M) Seed 20DAF _drought (Brenda) Seed 20DAF _drought (Hs584) Seedling _drou...
Ngày tải lên: 11/08/2014, 11:21
Static and Dynamic Analysis of Space frames
... result list of load cases, superposition files and influence lines 3.64 Version 8.38.03 • • • • Use of combination codes “SupOrX” and “SupAndX” for superposition files corrected New command “PLSCFAC” ... to choose between E- and Fformat of the written values Information about units added to the plot file of the action PlInfl, screen plot Results/ PlInfl and to the list file o...
Ngày tải lên: 06/09/2012, 15:18
Static and Dynamic Analysis of Spaceframes
... Disclaimer and Copyright Disclaimer Much time and effort have gone into the development and documentation of RM2000 and GP2000 The programs have been thoroughly tested and used The user accepts and ... the two load sets and the two loading cases (e.g.: L.C is a UDL of 10kN/m from Elem to Elem 20 and L.C is a Settlement of 0.001m at the beginning of element 1200.) Choos...
Ngày tải lên: 06/09/2012, 15:55