Modeling of the tool edge radius effect on the mechanics of micromachining
Modeling of the tool edge radius effect on the mechanics of micromachining
... MODELING OF THE TOOL EDGE RADIUS EFFECT ON THE MECHANICS OF MICROMACHINING WOON KENG SOON (B.Eng Hons.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MECHANICAL ... regions along the tool edge radius With this contact model, the tool wear phenomenon of edge- radiused’ cutting tools was reasonably elucidated Furthermore through the decrease of a/r from the ... process, the mechanics of toolbased micromachining is governed by the tool edge radius effect Such effect arises when the undeformed chip thickness, a is comparable to the size of the tool edge radius, ...
- 267
- 234
- 0
Multilevel modeling of the influence of surface transport peculiarities on growth, shaping, and doping of si nanowires
... function The second equation of the system describes the NW axial growth due to bulk diffusion of silicon atoms from the surface to the catalyst/NW interface Here, h is the height of the NW and ... manner, the output flux is the number of adatoms leaving the given region of the surface (due to the surface transport) , per one MC time step and per unit of the boundary length The surface transport ... shell growth, a sharp decrease in the surface concentration, and the corresponding slowdown of the axial growth As a result of such fluctuations in the input flux and the surface coverage during the...
- 8
- 514
- 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx
... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...
- 5
- 435
- 0
Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx
... was played on a Sunday afternoon, three days after the Thursday auction The other pair of tickets was to a regular season baseball game, between the Red ALWAYS LEAVE HOME Sox and the Toronto Blue ... Blue Jays There was also a consolation prize of a pair of banners (one featuring the Celtics and one featuring the Red Sox) We did not provide information about the market values of any of the ... to effect willingness to pay This suggests an association bias in which respondents have positive associations for credit cards that in¯ate their willingness to pay regardless of the actual payment...
- 8
- 344
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... expression of VRK2A and VRK2B proteins in tumour cell lines To demonstrate that the two messages identified code for real proteins, we determined their presence in a panel of tumour cell lines using ... specificity of VRK2 isoforms and p53 phosphorylation To identify and confirm the subcellular localization of both VRK2 isoforms the cDNA of each isoform was cloned in pCEFL–HA vector that contains an ... the biological effects mediated by these kinases might be determined by their subcellular localization and the proteins present in the corresponding compartment, and by their C-terminal domain,...
- 18
- 333
- 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)...
- 11
- 427
- 0
báo cáo hóa học:" TMD pain: the effect on health related quality of life and the influence of pain duration" pdf
... article as: Tjakkes et al., TMD pain: the effect on health related quality of life and the influence of pain duration Health and Quality of Life Outcomes 2010, 8:46 Page of ... consent Quality of life has been described by the World Health Organisation as " an individual's perception of their position in life in the context of the culture and value system of which they ... from pain for over months (chronic group) It is not clear whether and, if so, how (chronic) pain related to TMDs influences HRQoL, and whether pain duration is of influence It may be hypothesized...
- 8
- 315
- 0
Báo cáo hóa học: " Large-scale fabrication of ordered arrays of microcontainers and the restraint effect on growth of CuO nanowires" ppt
... exist CuO nanowires on the outside surface of microcontainers in our case However, we not observe any CuO nanowires on the outer surface of microcontainers We believe that the growth of CuO nanowires ... compact The CuO film can only expand along normal direction of the surface Due to space limit, CuO film on the inner surface of microcontainer will become concentrated as expansion, while the Figure ... http://www.nanoscalereslett.com/content/6/1/86 Page of design of the study and discussion of growth mechanism of CuO nanowires NX participated in the design of the study, and critically revised the manuscript...
- 4
- 387
- 0
Báo cáo hóa học: " Growth Interruption Effect on the Fabrication of GaAs Concentric Multiple Rings by Droplet Epitaxy" pptx
... framework of the effective mass approximation [17–20], allowing us to attribute Peak to the emission of the localized states within the CTQRs On the other hand, on the basis of the same theoretical ... that of the original droplets, confirming that all Ga droplets transformed into GaAs triple rings at the end of the procedure As already discussed in Ref [14], the formation of the inner rings ... comes from the crystallization of the droplets edge, thus explaining the identity between droplets and inner rings diameters On the contrary, middle and outer rings appear caused by the subsequent...
- 4
- 384
- 0
Báo cáo lâm nghiệp: "Diversity of endomycorrhizal fungi and their synergistic effect on the growth of Acacia catechu Willd." pot
... mind, the present study was undertaken to determine the effect of double and triple inoculation (co-inoculation) of AM fungi with other rhizospheric microflora on the growth performance of A catechu ... or their combinations could have an important effect on nodulation and nitrogen fixation in legumes The principal effect of mycorrhiza on nodulation is P-mediated The combined inoculations of ... the results that all the inoculations had a higher P content of shoots and roots than the control P content of roots was higher than P content of shoots in all the inoculated seedlings of A catechu...
- 8
- 368
- 0
Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx
... density on the number of nematodes per plant and the leaf mineral concentrations Mycorrhizal treatments Number of nematodes inoculated Number of nematodes per plant Mineral concentrations (% of dry ... Ectomycorrhization of Acacia holosericea in Senegal 25 °C in the dark in order to achieve a good coverage of the paper card The filter paper covering the roots was removed and the mycelium colonizing the ... axenic conditions between A holosericea and different 348 R Duponnois et al Table I Effect of Meloidogyne javanica inoculum density and inoculation with Pisolithus sp COI 024 on growth and ectomycorrhizal...
- 6
- 348
- 0
Báo cáo toán học: "he environmental effect on crown shape of common cypress clones in the Mediterranean countries" pdf
... accordingly, different patterns of response to environmental factors The main purpose of this research was to measure the influence of the environmental factors on crown shape of cypress clones, ... 0.37 The environmental effect on cypress crown 281 Figure Virtual images of the crown of clone 318F, obtained from the mean of the measurements made on 10 ramets in each of the six locations Figure ... and the particular environments in which it grows, involving the alteration of a suite of characters, then it is worth considering whether, at least as regards the shape of the crown, the clones...
- 10
- 287
- 0
Báo cáo khoa học: "An assessment of edge effect on growth and timber external quality of ayous (Triplochiton scleroxylon K Schum) under Cameroon rain forest conditions" docx
... functions for modelling the border effect on diameter of ayous (Triplochiton scleroxylon K Schum) For Ecol Manage (in press) Pesme X (1986) L Ayous (Triplochiton scleroxylon K Schum) en plantation ... Cesalpiniaceae forest and a semi-deciduous forest of Sterculiaceae and Ulmaceae (Letouzey, 1968) The climate exhibits seasons, namely rainy and dry (with one long and one short of each type) The annual rainfall ... quantitative evaluation of the border effect on the growth and the external quality of the ayous timber Second, to determine the distance to which the effect is carried This aspect is of central importance...
- 8
- 383
- 0
Báo cáo khoa học: "The incidence of recurrent flushing and its effect on branch production in Quercus petraea (Matt) Liebl growing in southern England" ppt
... water and nutrients for shoot extension and leaf expansion (Bond, 1945) Interpretation of the data for lateral branch production by sections of shoot formed during FIRST, SECOND and SPRING flushes ... showing flushes On those showing a single SPRING flush, branches will be concentrated at the tip of the annual increment in length whereas there will be centres of branching on flush shoots: branches ... recurrent flushing The percentage of shoots showing SECOND flushes of growth between 1981 and 1990 are given in table I The proportion of leading shoots forming a second flush varied between 100% in...
- 9
- 324
- 0
Từ khóa: the broader impact of global working conditions the effect on familiesadherence to guidelines and its effect on glycemic control during the management of type 2 diabethe conclusion is a statement that captures the strength and consistency of the evidence of an intervention s effect on an outcome the following terms are used to characterize the body of evidence regarding an outcomebill apos s effect on the taxation of familiespressure and its effect on the rate and amount of microbial growththe possible effect on folate needs and risk of chronic diseasethe viscoelastic effect on the formation of mesoglobular phase of dilute heteropolymer solutionsuse of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variantsthe pain of childbirth and its effect on the mother and the fetusrefinement of methods for emulsion stabilization destabilization by means of the effect on both coalescence and flocculationbehavioral mediators of the human population effect on global biodiversity lossesmodeling the history effect on microbial growth and survival deterministic and stochastic approaches5the size of the additive and the scale effect on the lubricationsoil ph effect on the distribution of heavy metals among soil fractions3cdpro 3cproh40a has a small stimulating effect on the early steps of viral particle assemblyBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ