Modeling of the tool edge radius effect on the mechanics of micromachining
... MODELING OF THE TOOL EDGE RADIUS EFFECT ON THE MECHANICS OF MICROMACHINING WOON KENG SOON (B.Eng Hons.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MECHANICAL ... regions along the tool edge radius With this contact model, the tool wear phenomenon of edge- radiused’ cutting tools was reasonably elucidated Furthermore th...
Ngày tải lên: 14/09/2015, 14:01
... function The second equation of the system describes the NW axial growth due to bulk diffusion of silicon atoms from the surface to the catalyst/NW interface Here, h is the height of the NW and ... manner, the output flux is the number of adatoms leaving the given region of the surface (due to the surface transport) , per one MC time step and per un...
Ngày tải lên: 16/03/2014, 15:18
... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTG...
Ngày tải lên: 23/03/2014, 21:20
Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx
... was played on a Sunday afternoon, three days after the Thursday auction The other pair of tickets was to a regular season baseball game, between the Red ALWAYS LEAVE HOME Sox and the Toronto Blue ... Blue Jays There was also a consolation prize of a pair of banners (one featuring the Celtics and one featuring the Red Sox) We did not provide information abou...
Ngày tải lên: 29/03/2014, 03:21
Research " Goodwill Acounting Diffrences of the US and UK and Their Effect on Share Prices " pptx
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... expression of VRK2A and VRK2B proteins in tumour cell lines To demonstrate that the two messages identified code for real proteins, we determined their presence in a panel of tumour cell lines using ... specificity of VRK2 isoforms and p53 phosphorylation To identify and confirm the subcellular localization of both VRK2 isoforms the cDNA of each isofor...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAU...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" TMD pain: the effect on health related quality of life and the influence of pain duration" pdf
... article as: Tjakkes et al., TMD pain: the effect on health related quality of life and the influence of pain duration Health and Quality of Life Outcomes 2010, 8:46 Page of ... consent Quality of life has been described by the World Health Organisation as " an individual's perception of their position in life in the context of the...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " Large-scale fabrication of ordered arrays of microcontainers and the restraint effect on growth of CuO nanowires" ppt
... exist CuO nanowires on the outside surface of microcontainers in our case However, we not observe any CuO nanowires on the outer surface of microcontainers We believe that the growth of CuO nanowires ... compact The CuO film can only expand along normal direction of the surface Due to space limit, CuO film on the inner surface of microcontainer will...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo hóa học: " Growth Interruption Effect on the Fabrication of GaAs Concentric Multiple Rings by Droplet Epitaxy" pptx
... framework of the effective mass approximation [17–20], allowing us to attribute Peak to the emission of the localized states within the CTQRs On the other hand, on the basis of the same theoretical ... that of the original droplets, confirming that all Ga droplets transformed into GaAs triple rings at the end of the procedure As already discussed in Ref [1...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo lâm nghiệp: "Diversity of endomycorrhizal fungi and their synergistic effect on the growth of Acacia catechu Willd." pot
... mind, the present study was undertaken to determine the effect of double and triple inoculation (co-inoculation) of AM fungi with other rhizospheric microflora on the growth performance of A catechu ... or their combinations could have an important effect on nodulation and nitrogen fixation in legumes The principal effect of mycorrhiza on nodulation is...
Ngày tải lên: 07/08/2014, 04:20
Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx
... density on the number of nematodes per plant and the leaf mineral concentrations Mycorrhizal treatments Number of nematodes inoculated Number of nematodes per plant Mineral concentrations (% of dry ... Ectomycorrhization of Acacia holosericea in Senegal 25 °C in the dark in order to achieve a good coverage of the paper card The filter paper covering th...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo toán học: "he environmental effect on crown shape of common cypress clones in the Mediterranean countries" pdf
... accordingly, different patterns of response to environmental factors The main purpose of this research was to measure the influence of the environmental factors on crown shape of cypress clones, ... 0.37 The environmental effect on cypress crown 281 Figure Virtual images of the crown of clone 318F, obtained from the mean of the measurements...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo khoa học: "An assessment of edge effect on growth and timber external quality of ayous (Triplochiton scleroxylon K Schum) under Cameroon rain forest conditions" docx
... functions for modelling the border effect on diameter of ayous (Triplochiton scleroxylon K Schum) For Ecol Manage (in press) Pesme X (1986) L Ayous (Triplochiton scleroxylon K Schum) en plantation ... Cesalpiniaceae forest and a semi-deciduous forest of Sterculiaceae and Ulmaceae (Letouzey, 1968) The climate exhibits seasons, namely rainy and dry (with...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: "The incidence of recurrent flushing and its effect on branch production in Quercus petraea (Matt) Liebl growing in southern England" ppt
... water and nutrients for shoot extension and leaf expansion (Bond, 1945) Interpretation of the data for lateral branch production by sections of shoot formed during FIRST, SECOND and SPRING flushes ... showing flushes On those showing a single SPRING flush, branches will be concentrated at the tip of the annual increment in length whereas there will be centres of branchin...
Ngày tải lên: 08/08/2014, 23:22