A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

... and Christy’s previous publication (73), 117 4.4 Surface Plasmon Polariton Assisted Surface Enhanced Raman Scattering on Ultrasmooth Metal Surface The theory for an enhanced field near a metal ... distance of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is poi...

Ngày tải lên: 14/09/2015, 14:01

163 449 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1

... Theory of Enhanced Raman Scattering and its Experimental Verifications 2 .1 General Theory of Raman Scattering 13 2.2 Enhanced Raman Scattering 13 2.2 .1 Chemical Raman Enhancement 14 2.2.2 Electromagnetic ... Schematic diagram of SNOM system for phase measurements 17 0 17 1 Fig 15 A typical AFM and SNOM mappings of a 10 0-nm nano- cavity substrate wi...

Ngày tải lên: 14/09/2015, 14:02

129 265 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx

Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx

... Mathematical simulation and analysis of cellular metabolism and regulation Bioinformatics 1999, 15:749-758 Tomita M, Hashimoto K, Takahashi K, Shimizu TS, Matsuzaki Y, Miyoshi F, Saito K, Tanida ... disposable cells never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approx...

Ngày tải lên: 13/08/2014, 22:22

11 386 0
TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS

TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS

... go to substantially improve the effectiveness of the training The thesis explains the deployment of TFEL in the reform of vocational teaching activities for rural workers The analysis of the ... with the direct exchange of the contents related to the techniques and the application of experiential teaching in the VT of civil electri...

Ngày tải lên: 15/09/2015, 15:17

28 278 0
Báo cáo khoa học: "A Method for Word Sense Disambiguation of Unrestricted Text" potx

Báo cáo khoa học: "A Method for Word Sense Disambiguation of Unrestricted Text" potx

... untagged word1 - word2 pair (W1 - W2) OUTPUT: ranking the senses of one word PROCEDURE: STEP Form a similarity list ]or each sense of one of the words Pick one of the words, say W2, and using WordNet, ... using WordNet, form a similarity list for each sense of t h a t word For this, use the words from the synset of each sense and the words from the h y p e r n y m...

Ngày tải lên: 08/03/2014, 06:20

7 378 0
Báo cáo y học: "DarkHorse: a method for genome-wide prediction of horizontal gene transfer" pptx

Báo cáo y học: "DarkHorse: a method for genome-wide prediction of horizontal gene transfer" pptx

... 10:606-611 Pariasca JAT, Sunaga A, Miyazaki T, Hisaka H, Sonoda M, Nakagawa H, Sato T: Cloning of cDNAs encoding senescence-associated genes, ACC synthase and ACC oxidase from stored snow pea pods ... variability among proteins, mutation rates and database representation can also vary widely between taxa, so appropriate threshold values may need adjustment by query organism, as well as by...

Ngày tải lên: 14/08/2014, 17:22

18 480 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

... words for the articles These words show new information in the article, and make it easy to understand t h e content of the articles If a word in an article appears in the differentia words for its ... the story of the articles For example, the word "state" is the differentia word for dT, and is in its adjacent articles ds, dg, anddlo This means that d7 is a starting...

Ngày tải lên: 08/03/2014, 06:20

7 419 0
Báo cáo y học: "Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study" ppsx

Báo cáo y học: "Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study" ppsx

... each other revealing only two different nycthemeral rhythms We demonstrate that the nycthemeral rhythms on Friday and Saturday are equal and differ significantly from the rhythms of the other ... of the study, analyzed the data and drafted the manuscript UR contributed to the conception and the design of the study TB acquired the data IK contributed...

Ngày tải lên: 10/08/2014, 09:20

10 467 0
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A ... LG of the AA map, B6 with A6 and A1 0, and B7 with A7 and A8 Synteny analysis A total of 51 common markers mapped in the AA and...

Ngày tải lên: 12/08/2014, 03:20

10 399 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering dis...

Ngày tải lên: 12/09/2015, 08:20

236 494 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

... peer review to ensure that they meet high standards for research quality and objectivity Stress and Performance A Review of the Literature and Its Applicability to the Military Jennifer Kavanagh ... 198 1Stress and performance : a review of the literature and its applicability to the military / Jennifer Kavanagh p cm “TR-192.” Inclu...

Ngày tải lên: 29/03/2014, 18:20

86 607 0
Báo cáo khoa học: "A Case Analysis Method Cooperating with ATNG and Its Application to Machine Translation" pot

Báo cáo khoa học: "A Case Analysis Method Cooperating with ATNG and Its Application to Machine Translation" pot

... equivalent to several machine- language instructions, and they refer to m e m o r y locations by names called variables." One point is N M P analysis method by recursive calling for case frame analysis ... obligatory prepositional phrase name if the verb is intransitive Furthermore, the control moves to the next case slot to fill i t , i f the case frame has more slots,...

Ngày tải lên: 31/03/2014, 17:20

5 353 0
w