Investigating online trust of multi channel retailers the social relations and networks perspective
Investigating online trust of multi channel retailers the social relations and networks perspective
... Secondly, their offline interactions with the multi- channel retailer provides another mode of transference and through their social relations with the offline presence of the retailer, the retailer’ online ... Word -of- Mouth within Social Network Offline Cognitive Trust Trust in the Offline Operations of the Retailer H3 H4 Trust in the Online Operation...
Ngày tải lên: 14/09/2015, 13:13
Báo cáo hóa học: " Delay-throughput analysis of multi-channel MAC protocols in ad hoc networks" ppt
... Multi-Channel MAC protocols in ad hoc networks Research efforts in the field of access mechanisms for single-channel ad hoc networks have been extensive For example, a multiplicity of single-channel MAC protocols ... G-McMAC clearly outperforms SYN -MAC by offering lower delays in general However, G-McMAC becomes unstable before SYN -MAC and in fact after the s...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... proteins that display positively charged domains On this basis it was originally thought that the HS chains were essential for glypican activity Indeed, this seems to be the case for the glypican-induced ... has been proposed that glypicans can be involved in the uptake of polyamines [24] Glypicans can also be shed into the extracellular environment This shedding...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
... considered in this study are commonly identified on the basis of their catabolic capabilities, comparatively little is known about the regulation of their biosynthetic pathways In this study, we identified ... The most plausible hypothesis is that they encode a novel pathway for pimeloylCoA synthesis, as the known genes for this pathway, bioC, bioH, bioG and bioW, are...
Ngày tải lên: 14/08/2014, 14:21
understanding the process of multi-document summarization content selection, rewriting and evaluation
Ngày tải lên: 14/11/2014, 08:48
Design of multi channel spectrometers for scanning ion electron microscopes
... Schematic layout for the multi- channel secondary electron off-axis analyser reported by Kienle and Plies [1.31] New possibilities of using multi- channel energy spectrometers for other applications inside ... Introduction At present, the detection systems of the Scanning Electron Microscope (SEM) or Focused Ion Beam (FIB) are not generally designed to capture the ener...
Ngày tải lên: 09/09/2015, 09:59
Tài liệu The Social Benefits and Economic Costs of Taxation doc
... outcomes; they lead to the withdrawal of the haves from the life of the community and the exclusion of the have-nots; and, generally, inequality diminishes the richness and flourishing of a society ... 5.20 the social benefits and economic costs of ta x ation 43 appendix 1 Comparing Social and Economic Outcomes in Low- and High-Tax Countries D...
Ngày tải lên: 20/02/2014, 19:20
Protocol for Conducting Environmental Compliance Audits of Storage Tanks under the Resource Conservation and Recovery Act pdf
... herein V Protocol for Conducting Environmental Compliance Audits of Storage Tanks under RCRA - Checks”.column, will follow the same sequence or order of the citations listed at the end of the statement ... hcrein vi Protocol for Conducting Environmental Compliance Audits of Storage Tanks under RCRA prevent discovery of the same findings...
Ngày tải lên: 06/03/2014, 23:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx
... Kontinen, V.K., Brandt, A & Pertovaara, A (1999) Neuropeptide FF and modulation of pain Brain Res 848, 191–196 Ibata, Y. , Iijima, N., Kataoka, Y. , Kakihara, K., Tanaka, M., Hosoya, M & Hinuma, S (2000) ... in the brain and pituitary of the goldfish, Carassius auratus Ann Anat 174, 217–222 19 Iwakoshi, E., Hisada, M & Minakata, H (2000) Cardioactive peptides isolated from...
Ngày tải lên: 08/03/2014, 16:20
The impacts of introductions and stocking of exotic species in the Mekong Basin and policies for their control
... Introductions and Stocking of Exotic Species in the Mekong Basin and Policies for Their Control iv The Impacts of Introductions and Stocking of Exotic Species in the Mekong Basin and Policies for Their Control ... The Impacts of Introductions and Stocking of Exotic Species in the Mekong Basin and Po...
Ngày tải lên: 14/03/2014, 08:48
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
... increases the growth rate and shortens the duration of the cell cycle is the polymer-inherent isosterism of the carboxylates with the array of phosphates in nucleic acids and, consequently, the ... the mechanism(s) underlying the increase in the growth rate and the shortening of the cell cycle might be related to the ability of PMLA...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Essential roles of lipoyl domains in the activated function and control of pyruvate dehydrogenase kinases and phosphatase isoform 1 pot
... processing unit Fig E2 and E3BP domains and their binding interactions E2 subunit domains: L1, N-terminal lipoyl domain; L2, inner lipoyl domain; B, E1 binding domain; I, oligomer-forming, acetyl-transferase-catalyzing ... L2 In a second region at the other end of the L2 domain, mutation of glutamates 16 2, 17 9 and 18 2, and glutamine 18 1 greatly reduces binding...
Ngày tải lên: 17/03/2014, 09:20
Trends of Health Education in the Developed Countries and Recommendations for Health Education in the Kingdom Of Saudi Arabia potx
... study the trends in university health education in the developed countries and recommend ambitious future trends and directions for the university health education in the Kingdom of Saudi Arabia for ... pharmacy education trends in developed countries in the fields of pharmaceutical sciences and determining special trends perta...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Influence of divalent cations on the structural thermostability and thermal inactivation kinetics of class II xylose isomerases pdf
... enzyme’s inactivation kinetics, the inactivation course of TNXI in the presence of various metal concentrations and metal combinations was determined Figure shows the inactivation courses of apo-TNXI ... courses of apo-TNXI and of TNXI in the presence of mm concentrations of each of the three divalent cations (Mg2+, Mn2+, or Co2+) With the exception...
Ngày tải lên: 23/03/2014, 13:20