Improved modelling of the human cerebral vasculature

... components” The strength of the connectedness describes the degree of the adjacency of the grid points as well as the similarities of their intensity values In defining a fuzzy object, the strength of ... consist of connected sets of vessels that supply the front and top of the head The vertebral arterial circulation supplies the rest of the brain suc...

Ngày tải lên: 14/09/2015, 12:48

... reported that 5% of the cases of oral squamous cell carcinoma show diminished expression of hMSH2 protein In the present study, we demonstrated decreased expression of hMSH2 protein in reticular ... OLP subtypes Figure Positive labelling for hMSH2 protein in basal and intermediate epithelial layers of reticular subtype of oral lichen planus patient (str...

Ngày tải lên: 03/11/2012, 09:54

... in proverbs referring to parts of the human body 3.4 Personification in proverbs referring to parts of the human body Table The meanings of English proverbs referring to parts of the human body ... to parts of the human body Chapter A contrastive analysis on English and Vietnamese proverbs referring to parts...

Ngày tải lên: 12/12/2013, 00:03

... of class of words denoting parts of human body in English and VietNamese on semantic transference 2.1 The origin of names referring to parts of the human body According to the aspect of origin, ... features - The amount of meanings In English, there are 82 words having primary meaning referring to parts of the human body possess...

Ngày tải lên: 18/12/2013, 21:45

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... HsRad51 to examine whether these loops are actually involved in DNA binding Because aromatic residues are involved in the ssDNA binding by bacterial single stranded DNA- binding protein (SSB) and ... mutagenesis across the HsRad51 -L1 loop, and tested the interaction between the L1 loop and DNA A D B E Involvement of the L1 loop-Tyr232 residue in DNA...

Ngày tải lên: 19/02/2014, 06:20

... from the human KLK11 gene We determined the nucleotide sequences of 15 clones of the PCR products from the human prostate by oligo cap RACE in order to determine the transcrip- Multiple promoters ... type of KLK11, isoform 2, despite the presence of exon 1c The secretory pathways of KLK11 isoforms appeared to differ, although both isoforms were secreted from ce...

Ngày tải lên: 19/02/2014, 06:20

... compares the studied network with randomized versions of it with the same size and degree distribution The so-called Z-score quantifies the difference between the studied network and an ensemble of randomized ... functions, and topological features retain functionality and phylogeny However, the nature of the connections between these factors needs to be underst...

Ngày tải lên: 19/02/2014, 07:20

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...

Ngày tải lên: 19/02/2014, 16:20

... siRNA selection [43] The first siRNAZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3 ) matched bases 192–210; the second siRNAZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU ... human (GCC)n-binding protein Fig Identification of p56 polypeptide as Kruppel-like transcription factor ZF5 by MALDI-TOF assay (A) Fragment of MALDI-TOF spectru...

Ngày tải lên: 07/03/2014, 05:20

... against MUC5AC, with epitopes located in the MUC5AC C-terminal cysteine-rich part Further localization of the epitopes of 45M1, 2-12 M1 and 166M1 In order to further locate the epitopes of the hitherto ... in the N-terminal region of the C-terminal cysteine-rich part of MUC5AC, presumably in the last CysD domain of the mucin The epitope of...

Ngày tải lên: 07/03/2014, 05:20

... binding to Ppp4c Subunit type S cerevisiae Drosophila Human Catalytic subunit Core regulatory subunit of Pph3 ⁄ Ppp4c Regulatory subunit of Pph3 ⁄ Ppp4c Core regulatory subunit of Ppp4c Catalytic subunit ... BY4 743 pph3D::kanMX4 ⁄ pph3D::kanMX4 BY4 743 psy4D::kanMX4 ⁄ psy4D::kanMX4 BY4 743 psy2D::kanMX4 ⁄ psy2D::kanMX4 BY4 743 TUB2 ⁄ tub2D::HIS3MX BY4 743 TU...

Ngày tải lên: 07/03/2014, 12:20

... Attenuation of LXF-289 cell proliferation by ATP is mediated by the activation of the MEK ⁄ ERK1 ⁄ 2, PI3K and p38 MAPK pathways Activation and translocation of the transcription factors NF -jB1 (p50) and ... Table Inhibition of proliferation of LXF-289 lung tumor cells Effects of signaling pathway inhibitors on ATP-inhibited proliferation (A)...

Ngày tải lên: 07/03/2014, 12:20

... ligation of a stretch of DNA to repair the gap created by the excision In TCR, stalled RNA polymerase II acts as a marker for recognition of the lesion by the DNA repair machinery With respect to the ... XPG The results of intricate studies designed to characterize these interactions are reviewed below Fig Scheme of the global genomic repair (GGR) pathway...

Ngày tải lên: 07/03/2014, 12:20

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...

Ngày tải lên: 07/03/2014, 15:20