Development of dielectrophoresis devices for cell manipulation

Development of dielectrophoresis devices for cell manipulation

Development of dielectrophoresis devices for cell manipulation

... DEVELOPMENT OF DIELECTROPHORESIS DEVICES FOR CELL MANIPULATION YU LIMING (B.S., M.S.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MECHANICAL ENGINEERING ... only for fabrication of our devices, but also for other MEMS applications Chapter explores the applications of DEP chips with 3D silicon microchannel walls for cell manipulat...

Ngày tải lên: 14/09/2015, 11:45

200 398 0
development of new human stem cell   derived cellular vehicles for glioma gene therapy

development of new human stem cell derived cellular vehicles for glioma gene therapy

... DEVELOPMENT OF NEW HUMAN STEM CELLDERIVED CELLULAR VEHICLES FOR GLIOMA GENE THERAPY ZHAO YING (B Sc., PKU; M Sc., PKU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... stem cells by adherent monoculture 4.3.2 “Stemness” of human embryonic stem cell- derived neural 127 stem cells 4.3.3 In vitro glioma tropism evaluation o...

Ngày tải lên: 11/09/2015, 09:00

193 256 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...

Ngày tải lên: 05/09/2013, 16:11

12 557 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx

Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx

... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefo...

Ngày tải lên: 08/03/2014, 21:20

4 436 0
DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx

DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx

... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Sp...

Ngày tải lên: 29/03/2014, 23:20

32 470 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

... evaluate the therapeutic potential of expression vectors carrying the "A" fragment of the diphtheria toxin (DT -A) gene under the control of the H19 regulatory sequences in an ovarian carcinoma ... expression profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA -H19 vector was tested in a rat ani...

Ngày tải lên: 18/06/2014, 15:20

11 559 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

... an approach for targeted therapy of bladder carcinoma by driving the DTA expression under the control of IGF2-P4 and H19 regulatory sequences To evaluate the possible use of IGF2-P4 and H19 regulatory ... therapy is an attractive approach Based on early studies of our group and others, the transcriptional regulatory sequences of the H19...

Ngày tải lên: 18/06/2014, 16:20

18 746 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 18/06/2014, 18:20

13 456 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx

Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 20/06/2014, 01:20

13 431 0
Collaboration for Agriculture & Rural Development:Sustainable and profitable development of acacia plantations for sawlog production in Vietnam - Milestone 12 " pdf

Collaboration for Agriculture & Rural Development:Sustainable and profitable development of acacia plantations for sawlog production in Vietnam - Milestone 12 " pdf

... phân bón) singling young acacia plantations to produce single-stemmed 12 11 - - - - - - - trees, 3-6 months after planting (tỉa bỏ để lại thân sau – tháng trồng) form-pruning young acacia plantations ... khác?) 7 - nursery management and seedling production (quản lý vườn ươm thu hái hạt) - - - - - - - plantation establishment (si...

Ngày tải lên: 21/06/2014, 06:20

7 363 0
Project Progress Report: " Sustainable and profitable development of acacia plantations for sawlog production in Vietnam " pdf

Project Progress Report: " Sustainable and profitable development of acacia plantations for sawlog production in Vietnam " pdf

... (shavings etc) The participants were able to see all aspects of the operation: rough sawing, drying, measuring and cutting piece sizes; final shaping, planing and form work; drilling, assembly and ... tip pruning and how to apply it The participants then spent 30 minutes practising form pruning and familiarising themselves with the use of the various tools (Plates 2-4) Stand 2:...

Ngày tải lên: 21/06/2014, 06:20

18 441 0
w