Structural and functional studies of VP9, a novel nonstructural protein from white spot syndrome virus

... Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional ... Birnaviridae, Bunyaviridae, Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae, Iridoviridae, Nodaviridae and Nimaviridae Crustacean viral diseases listed by the OIE (Office ... past 40 years 17 Sitting and hanging drop methods are easy to manipulate, require a small amount of sample, and allow large amount of flexibility during screening and optimization Once a lead...

Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra) and its geographical distribution (A) An adult king cobra ... hypotensive and vasorelaxant properties Isolated from the venom of Atractaspis engaddensis These isopeptides are structurally and functionally related to mammalian endothelins They are potent vacoconstrictors...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...

Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

... STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF TRX16, A THIOREDOXIN-LIKE PROTEIN AND ALTERING SUBSTRATE SPECIFICITY OF SPI1, A PROTEASE INHIBITOR PANKAJ KUMAR GIRI A THESIS SUBMITTED ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and Babu, 2001), burns (Latha ... stress and characterization of its interaction with NF-kB Chapter IV presents the structure based rational design of altered specificity of a protease inhibitor Protease inhibitors play a decisive...

Functional studies of BPGAP1, a novel BCH domain containing RhoGAP protein

... and ARAP3 (Krugmann et al., 2002; Miura et al., 2002) All these three ARAP contain five PH domains, an ArfGAP domain and a RhoGAP domain (Miura et al., 2002) ARAP1 and ARAP3 have equal GAP activity ... Sekimata et al., 1999) PSGAP, a protein that interacts with PYK2 and FAD and contains multiple domains including a pleckstrin homology (PH) domain, a RhoGAP- activating protein domain and a Src ... 1.3.2 The BCH domain, a novel protein- protein interaction domain BCH domain was first demonstrated as a novel protein- protein interaction domain when it was found that BNIP-2 and Cdc42GAP could...

Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx

... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cytosolic sPPases ... biotic and abiotic stress conditions [13,15] This work shows that cyanobacterial strains as well as diverse anoxygenic photosynthetic bacteria possess family I sPPases with different catalytic...

Báo cáo y học: "Anti-inflammatory and arthritic effects of thiacremonone, a novel sulfurcompound isolated from garlic via inhibition of NF-κB" pptx

... radiographic analysis of arthritic hind paws and HJ isolated thiacremonone from garlic and provided SBH participated in data analysis and helped to draft the manuscript All authors read and approved ... 14 Rahman K: Historical perspective on garlic and cardiovascular disease J Nutr 2001, 131:977S-979S Tanaka S, Haruma K, Yoshihara M, Kajiyama G, Kira K, Amagase H, Chayama K: Aged garlic extract ... cyclooxygenase-2 (COX-2) and iNOS As a result, inhibition of signal pathways leading to inactivation of NF-κB is now widely recognized as a valid strategy combating autoimmune, inflammatory, and...

Functional characterization of isthmin, a novel secreted protein in angiogenesis

... proteins, protein kinases and phosphatases Actin binding proteins that localize at FA sites include talin, tensin, paxillin, vinculin and α-actinin (Yam, et al., 2009) The assembly of FAs can be induced ... and adaptor proteins in focal adhesion complexes There are 25 four main signaling pathways activated by integrins that are relevant to angiogenesis: Ras-mitogen-activated protein kinase (MARK), ... vascular defects in the placenta and brain, and intestine α6β4 Laminin β4 Lethal at birth, no vascular defects in development 27 Fig 1.4 Signaling pathways initiated by integrins at focal...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and puriﬁcation of St SurE The SurE gene was PCR ampliﬁed from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ATP ... et al UMP kinase from Ureaplasma parvum Swedish Research Council for the Environment, Agricultural Sciences, and Spatial Planning (FORMAS) References Pollack JD (2001) Ureaplasma parvum: an opportunity...

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Puriﬁcation of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on ... staining when CaCl2 is added to the staining and washing buffer (Fig 1) Measurement of antifreeze activity Antifreeze activity was measured on equimolar amounts of deglycosylated and untreated...

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’- untranslated region of GS 1a was obtained by cleavage with ... with the reporter gene uidA and the presence of DNA-protein interactions in the 5’flanking region of GS 1a gene from Scots pine MATERIALS AND METHODS 2.1 Isolation of a genomic clone containing...

Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

... obtain chromosomal occupancy profiles at different growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able ... [15] Protein-DNA complexes are purified by precipi tation with antibodies against the protein, and the DNA fragments are then separated and analyzed by microarray http://genomebiology.com/2009/10/12/247 ... obtain a dynamic picture of protein occupancy for NAPs along the different growth phases of a bacterial culture As each NAP is produced maximally at different growth phases, one would expect that...

Báo cáo y học: "Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review" ppsx

... M, Kamegaya Y, Yokomori H, Han JY, Akiba Y, Nakamura M, Ishii H, Tsuchiya M: Roles of plasma membrane Ca++ – ATPase in the relaxation and contraction of hepatic sinusoidal endothelial fenestrae ... Microscopy 1996, 10:225-236 Oda M, Nakamura M, Watanabe N, Ohya Y, Sekuzuka E, Tsukada N, Yonei Y, Komatsu H, Nagata H, Tsuchiya M: Some dynamic aspects of the hepatic microcirculation – demonstration ... Hepatocellular carcinoma developed on noncirrhotic livers Sinusoids in hepatocellular carcinoma Arch Pathol Lab Med 1987, 111:174-180 Ichida T, Hata K, Yamada S, Hatano T, Miyagiwa M, Miyabayashi C, Matsui...

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to ﬁnd out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level After identiﬁcation of a PIN domain in the MCPIP ... shown) Of the identiﬁed proteins, 73% are proteins involved in mRNA stability, but there are also proteins involved in other cellular processes, such as actin Further studies characterizing proteins...

Xem thêm