Structural and functional studies of VP9, a novel nonstructural protein from white spot syndrome virus

... Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional ... Birnaviridae, Bunyaviridae, Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae, Iridoviridae, Nodaviridae and Nimaviridae Crustacean viral dise...

Ngày tải lên: 14/09/2015, 09:57

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra)...

Ngày tải lên: 10/09/2015, 08:37

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF TRX16, A THIOREDOXIN-LIKE PROTEIN AND ALTERING SUBSTRATE SPECIFICITY OF SPI1, A PROTEASE INHIBITOR PANKAJ KUMAR GIRI A THESIS SUBMITTED ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and...

Ngày tải lên: 09/09/2015, 18:55

... and ARAP3 (Krugmann et al., 2002; Miura et al., 2002) All these three ARAP contain five PH domains, an ArfGAP domain and a RhoGAP domain (Miura et al., 2002) ARAP1 and ARAP3 have equal GAP activity ... Sekimata et al., 1999) PSGAP, a protein that interacts with PYK2 and FAD and contains multiple domains including a pleckstrin homology (PH) domain, a RhoGAP- activating prote...

Ngày tải lên: 17/09/2015, 17:20

... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cyto...

Ngày tải lên: 16/03/2014, 11:20

... radiographic analysis of arthritic hind paws and HJ isolated thiacremonone from garlic and provided SBH participated in data analysis and helped to draft the manuscript All authors read and approved ... 14 Rahman K: Historical perspective on garlic and cardiovascular disease J Nutr 2001, 131:977S-979S Tanaka S, Haruma K, Yoshihara M, Kajiyama G, Kira K, Amagase H, Chayam...

Ngày tải lên: 09/08/2014, 14:22

... proteins, protein kinases and phosphatases Actin binding proteins that localize at FA sites include talin, tensin, paxillin, vinculin and α-actinin (Yam, et al., 2009) The assembly of FAs can be induced ... and adaptor proteins in focal adhesion complexes There are 25    four main signaling pathways activated by integrins that are relevant to angiogenesis: Ras-mitogen-activated protei...

Ngày tải lên: 14/09/2015, 08:25

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’- untranslated region...

Ngày tải lên: 08/08/2014, 14:20

... obtain chromosomal occupancy profiles at different growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able ... [15] Protein-DNA complexes are purified by precipi­ tation with antibodies against the protein, and the DNA fragments are then separated and analyzed by microarray http://genomebiolog...

Ngày tải lên: 09/08/2014, 20:21

... M, Kamegaya Y, Yokomori H, Han JY, Akiba Y, Nakamura M, Ishii H, Tsuchiya M: Roles of plasma membrane Ca++ – ATPase in the relaxation and contraction of hepatic sinusoidal endothelial fenestrae ... Microscopy 1996, 10:225-236 Oda M, Nakamura M, Watanabe N, Ohya Y, Sekuzuka E, Tsukada N, Yonei Y, Komatsu H, Nagata H, Tsuchiya M: Some dynamic aspects of the hepatic microcircul...

Ngày tải lên: 13/08/2014, 13:20

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level...

Ngày tải lên: 18/02/2014, 14:20