Transglutaminase in human corneal epithelial cells

... light-induced apoptosis…………….……………………… 40 4.2 UVB-induced apoptosis in corneal epithelial cells ……………… 41 4.3 Transglutaminase in corneal epithelial cell apoptosis…………………… 43 V Transglutaminase ... the role of transglutaminase (TGM)-2 in global gene expression in pterygium and human corneal epithelial cells, understand the role of TGM-2 in corneal epithelia...

Ngày tải lên: 14/09/2015, 08:48

... of cytokines upon V cholerae infection in intestinal epithelial cells Reports have shown the induction of IL-8 in intestinal epithelial cells upon V cholerae infection [11–13] The induction of ... upregulation of many proinflammatory mediators, such as cytokines [14] However, little is known about the role of V cholerae in initiating and sustaining t...

Ngày tải lên: 18/02/2014, 16:20

... Lam et al.: Profiles of cytokine and chemokine gene expression in human pulmonary epithelial cells induced by human and avian influenza viruses Virology Journal 2010 7:344 Submit your next manuscript ... of cytokine/ chemokine biosynthesis may be interrupted by the viral components Cytokines and chemokines generally function in an autocrine (on t...

Ngày tải lên: 12/08/2014, 02:20

... Hepcidin is expressed in airway epithelial cells and is regulated by IFN-g To determine whether hepcidin is expressed locally in airway epithelial cells and is regulated in response to pro-inflammatory ... hypothesized that hepcidin is expressed by airway epithelial cells We further postulated that hepcidin expression is coordinated by pro-infla...

Ngày tải lên: 12/08/2014, 13:22

... the kidney, EMT can be induced by TGFβ1, leading to increased collagen deposition and disruption of the epithelial integrity [17] TGFβ1 is known to be expressed by a variety of inflammatory and ... myofibroblasts [10-12] Recently, the hypothesis that myofibroblasts arise from epithelial cells through epithelial to mesenchymal transition (EMT) has been proposed [1...

Ngày tải lên: 12/08/2014, 14:20

... by compounds in cigarette smoke involve a combination of direct and indirect effects on cells, but principally center around an increase in airway inflammation as a result of cigarette smoking ... also showed an increase in nuclear staining of phosphorylated IκB as detected by immunocytochemical staining using an antibody to phosphorylated IκB (Fig 4B) Effect of cigarette...

Ngày tải lên: 12/08/2014, 18:20

... prostaglandins (PGs) play important roles in inflammatory process of respiratory system [7] PGs are synthesized from arachidonic acid by a reaction catalyzed by cyclooxygenase Two isoforms of this enzyme ... constitutively in almost all tissues [9], and COX-2 is an inducible enzyme that is expressed in response to inflammatory cytokines [10] Increased expression of COX-2 has bee...

Ngày tải lên: 12/08/2014, 18:21

... by epithelial and/ or endothelial injury involving the structures of the alveolar wall The alveolar surface area of the lung is covered with a layer of alveolar epithelial cells type I and type ... To increase our knowledge in mechanisms controlling the recruitment and activation of inflammatory cells in the alveolar space and the role of alveolar epithelial...

Ngày tải lên: 12/08/2014, 18:21

... pathogenicity of the avian influenza H9N2 viruses remains to be investigated Recent studies have shown that avian or human influenza viruses including H5N1, H7N1 and H1N1 can infect cells in the human ... the differential replication of H9N2 virus subtypes in human lung epithelial cells It provides a cellular model to investigate the mechanisms of replic...

Ngày tải lên: 12/08/2014, 04:20

... effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells Respir Res 2006, ... evidence of apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial ce...

Ngày tải lên: 12/08/2014, 15:21

... cells Cigarette smoke extract differentially caused cytotoxicity in a variety of alveolar epithelial cells and in primary human small airway epithelial cells A Various alveolar epithelial cells ... epithelial cell lines as well as in primary human small airway epithelial cells However, CSE triggered NF-κB activation and pro-inflammator...

Ngày tải lên: 12/08/2014, 16:20

... are to be understood Second, these findings indicate that outside the lymphatic system, CD30 antigen expression in the epithelial cells of developing intestinal crypts can mediate signals for cell ... of the developing fetal intestinal crypts suggests that previous views about the nature of the Ki-1 antigen must be re-examined The Hodgkin and ReedSt...

Ngày tải lên: 13/08/2014, 22:22

... SLC4A2, SLC4A3, SLC4A7 and SLC4A5 in ‘moderate expression , SLC4A1, SLC4A8, SLC4A10 and SLC4A9 in ‘very low expression Interestingly, during culturing of vi HCECs the expression of SLC4A11 in ... 3.1 Investigation of expression of Slc4 transporter family in MCECs In order to compare the mRNA expression levels of Slc4 gene family members in mouse...

Ngày tải lên: 13/10/2015, 15:54

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

... Role of JNK in radiation- induced mitochondrial cell death M.-J Kim et al Fig Ionizing radiation induces expression of Fas and activation of caspases in human cervical cancer cells (A) Ionizing radiation- induced ... development of molecular targets for cancer treatment Results To examine the kinetics of the apoptotic cell death induced by ionizi...

Ngày tải lên: 07/03/2014, 05:20