Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 3

... 7.45 (4H, t, J = Hz, meta-proton) 13 C NMR δc (d6-DMSO): For 134 Chapter ZnSe & CdSe NPs selenobenzoate ligand: 127 .12 (C2/6 or C3/5), 128 .61 (C2/6 or C3/5), 131 .05 (C4), 142.94 (C1), 201.50 (COSe) ... Experimental d-spacing d-spacinga 3. 659 3. 665 0 3. 611 3. 611 0 3. 460 3. 460 3. 235 3. 239 2 .122 2 .122 2.094 2.086 1.951 1.942 1.809 1.802 2 1.792 1.781 a d-spacing...

Ngày tải lên: 14/09/2015, 08:46

... NPs··················································· IR spectra of TOPO, ZnSe and CdSe NPs··································· 12 4 12 5 12 5 12 6 12 7 12 7 12 7 12 8 12 9 13 0 13 0 13 1 13 2 13 2 13 3 Chapter Figure 9 .1 Figure 9.2 Figure 9.3 Figure ... Powder Diffraction 18 0 12 . 10 Single Crystal X-ray Diffraction 18 0 12 . 11 Scanning Electro...

Ngày tải lên: 14/09/2015, 10:05

... Copper Selenide NPs Synthesis of Cu2-xSe NPs and Microflakes from [(Ph3P)3Cu2(SeC{O}Ph )2] 7.1 Introduction Cu2-xSe is an extrinsic p-type semiconductor with a direct band gap of 2. 2 eV and an ... of solvent on the formation of Cu2-xSe NPs 7 .2 Formation and Characterization of Cu2-xSe NPs and Microflakes 7 .2. 1 HDA and TOP as Surfactants The TEM images of Cu2-...

Ngày tải lên: 14/09/2015, 10:19

... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide...

Ngày tải lên: 22/06/2014, 22:20

... mutagenesis: ELM13M14 (5¢-AAGTCCCAAAATATTATGGA TATGATGGCTCGATTTCTCGAG-3¢); ELE28 (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ... for E lagascae SCP-2 (SCPElNE, 5¢-ACTGGAA TTCAACTCAAGTCCCAAAATATTTTGGAT-3¢; SCPElCN, 5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) and E lagascae EF1 -a (ELEFF, 5¢-TATGGT GGTTGAGACTTT...

Ngày tải lên: 16/03/2014, 12:20

... (University of Cambridge School of Clinical Medicine, UK) presented data from a murine model of inflammatory arthritis that suggested a role for regulatory T cells in the repression of arthritis and ... tolerated for decades, without global immunosuppression, they seem a promising therapeutic strategy for Th1-dominant inflammatory diseases, such as RA Homing and effe...

Ngày tải lên: 09/08/2014, 01:23

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

... to the 9th cycle from the N-terminus including the initiating Met: MHKTHSTMS for Sno1p and MTGEDFKIKS for Snz1p Properties of the complex of Sno1p and Snz1p When Sno1p with a His-tag and Snz1p ... SNO3, SNZ2 and SNZ3 complement the defect The relationship of all of these genes remains to be clarified Expression and purification of Sno1p and Snz1p In light...

Ngày tải lên: 19/02/2014, 12:20

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...

Ngày tải lên: 20/02/2014, 11:20

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenho...

Ngày tải lên: 07/03/2014, 05:20

... 6E) From these results it can be concluded that tRNAs were bound in classical states with the tRNAMet bound f in the P-sites of the 30S and 50S subunits and the tRNAPhe bound in the A-site of the ... SF and tRNA were added simultaneously to the reaction mixtures, in agreement with the results presented by Wendrich et al [7] tRNA and ribosome-dependent syn...

Ngày tải lên: 07/03/2014, 16:20

... preparation of CdSe quantum dots (QDs) by sol-gel method and investigate their optical properties This is a new route to get CdSe QDs and also very economic We also estimate the average size of QDs ... prepared CdSe nanoparticles and the positions of the Xray peaks for CdSe FCC are shown in Fig All the diffraction peaks from the CdSe nanoparticles are consistent...

Ngày tải lên: 14/03/2014, 13:20

... characteristics of the fabricated SiNWs solar cell under dark and light conditions the thickness of Si base substrate more thinly For improvement of conversion efficiency of the SiNWs solar cells, the ... performance Therefore, further reduction of the reflectance will be expected from the optimization of the synthesis conditions of SiNWs For analysis of the electri...

Ngày tải lên: 16/03/2014, 15:12

... the electrical and gas sensing behavior of ZnO nanowires Fig Characteristics of In3 O2 nanowires: (a) SEM image of In3 O2 nanowires, (b) TEM image of nanowire 70 nm in width, and (c) ED pattern ... image of a nanowire, and (e) linescan of the HAADF signal (solid line) and numerical fit of the shape of the nanowire (dashed line) As both composition and phase ca...

Ngày tải lên: 16/03/2014, 15:25

... El Ayeb, M., Rochat, H., Allen, P.D., Pessah, I.N., De Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine ... synthesis and characterization of Pi1, a scorpion toxin from Pandinus imperator active on K+ channels Eur J Biochem 267, 5149–5155 Lebrun, B.,...

Ngày tải lên: 17/03/2014, 10:20