Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 4
PURIFIED HERBA LEONURI AND LEONURINE PROTECT MIDDLE CEREBRAL ARTERY OCCLUDED-RATS FROM BRAIN INJURY THROUGH ANTIOXIDATIVE MECHANISM AND MITOCHONDRIAL PROTECTION
... Leonurine (4-guanidino-n-butyl Syringate) Protects the Middle Cerebral Artery Occluded-Rats through Antioxidant effect and Regulation of Mitochondrial Function………………………… 4.3.1 119 Effect of Leonurine ... Results……………………………………………………………… 89 Results of experiment I: Cerebral Protection of Purified Herba Leonuri Extract on Middle Cerebral Artery Occluded-Rats ……...
Ngày tải lên: 14/09/2015, 08:44
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 1
... that pHL contains mainly stachydrine (C7H13NO2), quercetin (C15H10O7) and kaempferol (C15H10O6), leonurine (C14H21N3O5) and apigenin (C15H10O5) (Figure 2 -10 ) Although the effects of single compounds ... toxicity of individual compounds and thus have better overall therapeutic efficacy (Loh et al, 2009) 2.3.3 Herba leonuri (HL) and purified Herba leonuri (pHL) Herba le...
Ngày tải lên: 14/09/2015, 08:45
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 3
... Leonurine- 500µM Leonurine- 1mM H2O2 + Leonurine- 10µM H2O2 + Leonurine- 100µM H2O2 + Leonurine- 500µM 10 H2O2 + Leonurine- 1mM 3. 4 .3. 4 In vivo mitochondrial studies 28 male Wistar rats were randomly divided ... pilot study of Leonurine 3. 4 .3. 3 In vitro mitochondrial studies For second part of study, effects of Leonurine on mitochondrial ROS generation and its func...
Ngày tải lên: 14/09/2015, 08:45
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 4
... Chapter 4: Results 4. 1 Results of experiment I: Cerebral Protection of Purified Herba Leonuri Extract on Middle Cerebral Artery Occluded Rats 4. 1.1 Pharmacological and functional outcome studies 4. 1.1.1 ... Chapter 4: Results 4. 3 Results of experiment III: Leonurine (4- guanidino-nbutyl Syringate) Protects the Middle Cerebral Artery Occluded- Rats t...
Ngày tải lên: 14/09/2015, 08:45
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 5
... value from stroke Leonurine treated group was also increased, suggesting that Leonurine could prevent the mitochondrial dysfunction from ischemic insult Mitochondrial GSH pool was balanced by Leonurine ... therapeutic potential of Leonurine on permanent MCAO Pretreatment of Leonurine at 60mg/kg/day for one week could protect rats from stroke insult by permanent MCAO In...
Ngày tải lên: 14/09/2015, 08:45
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection6
... 2006, 3: 327-337(a) Loh KP, Huang SH, Benny KH, Zhu YZ Cerebral Protection of Purified Herba Leonuri Extract on Middle Cerebral Artery Occluded Rats J Ethnopharmacol 2009, (Epub ahead of print) Loh ... of pHL and Leonurine, we aim at preventing mitochondrial ROS generation and protecting mitochondrial components from ROS-induced damage, to provide an environment w...
Ngày tải lên: 14/09/2015, 08:45
Studies on the mechanisms of the beneficial effects of herba leonuri and leonurine on traumatic brain injury in rat
... primary and secondary injury mechanisms The primary injury refers to the direct effects of mechanical injury on the brain tissue A primary injury can incur focal and/ or diffuse damage to the brain ... type of brain injury The pathology of brain injury includes cortical contusion, hemorrhage and a cytotoxic and/ or vasogenic brain edema which...
Ngày tải lên: 02/10/2015, 17:15
báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx
... efficacy on the cerebral infarction induced by permanent middle cerebral artery occlusion (pMCAO) in the rat, a clinically relevant model of ischemic stroke The effects of the COX-2 inhibitor nimesulide ... development of focal cerebral infarction induced by permanent middle cerebral artery occlusion (pMCAO) Figure Temporal developme...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo khoa học: " Canine model of ischemic stroke with permanent middle cerebral artery occlusion: clinical and histopathological findings" docx
... implemented a canine model of permanent embolic stroke Models of cerebral ischemia can Necropsy, TTC staining, and histopathology Atrophic and necrotic lesions were observed on the ventral surface of the ... left lateral ventricle and thalamus by mass effect were identified in all images Canine permanent MCAO model of ischemic stroke 373 Imaging analysis On t...
Ngày tải lên: 07/08/2014, 20:23
A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats
... A MIDDLE CEREBRAL ARTERY OCCLUSION MODELLING STUDY OF COMBINATORIAL TREATMENT (ACUTE PHASE) AND POST- ISCHEMIC EXERCISE (CHRONIC PHASE) IN RATS ELGIN YAP EE LIN (B Sc (Merits), NUS) A THESIS ... in rats with combined inhibitors treatment Fig (a) Intracellular ATP level following single and combined inhibitors administration of pan-caspase...
Ngày tải lên: 10/09/2015, 15:53
Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits
... regulated genes in the frontal cortex 48 Table 4: Down regulated genes in the frontal cortex 50 Table 5: Up regulated genes common in the middle cerebral artery and frontal cortex ... quantitatively and morphologically in 10 New Zealand White rabbits with and without hypertension, induced using the 2kidney, 1-clip Goldblatt hypertension model Genes i...
Ngày tải lên: 02/10/2015, 17:13
báo cáo hóa học: " Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?" docx
... TGAGATACGTGTTGACGTCC CTCTTCTCATTCCTGCTCGT CATAAGCCAACAAGTGGTATTCTC CAGGGAGATCTTGGAAATGAG TGACGGTCAGGTCATCACTATC TGAGTACTTCTCGGATGAAGG TTCCTTATTTCCTTTCACACCC GAGAAGATGATCTGAGTGTGAG TGTTTGGGATCCACACTCTC GGCAAATTTCCTGGTTATATCC ... Following weighing and shaving, the animals were placed in supine position on a heating pad and allowed to breathe spontaneously through a facemask Isoflurane...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps
... immediate CT brain scan in acute middle cerebral artery (MCA) infarction may initially appear normal and the low density area may not be apparent Some early signs of acute MCA infarction are loss of ... contrast (unenhanced) thus avoiding potential confusion with subarachnoid haemorrhage Below, we summarise the findings and analysis of CT scanning of the brain Norm...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Differential influence of arterial blood glucose on cerebral metabolism following severe traumatic brain injury" pptx
... stability Which arterial blood glucose concentration is optimal after severe TBI? Under conditions of relative cerebral glucose insufficiency due to increased cerebral glycolysis or absolute glucose ... increased cerebral glucose consumption [56] Glucose and secondary cerebral damage Any decrease in arterial glucose will impair cerebral glucosedependent pathway...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: "Optimizing cerebral glucose in severe traumatic brain injury: still some way to go" pdf
... Kelly DF, Vespa PM, Martin NA, Phelps ME, McArthur DL, Caron MJ, Kraus JF, Becker DP: Cerebral hyperglycolysis following severe traumatic brain injury in humans: a positron emission tomography ... T, Martin N, Hovda D: Intensive insulin therapy reduces microdialysis glucose values without altering glucose utilization or improving lactate/pyruvate ratio after traumatic brain...
Ngày tải lên: 13/08/2014, 16:20