Identification and characterization of CIS regulatory elements for vertebrate developmental control genes

... locate and validate candidate cis- regulatory elements for developmental control genes that are ancient in origin and conserved in evolution 1.1 Cis- Regulatory Elements Cis- regulatory elements ... methods to locate and validate cis- regulatory elements 17 1.5 Genomics era methods to locate and validate cis- regulatory elements ……20 1.6 In silico predic...

Ngày tải lên: 14/09/2015, 08:40

... specificity and sensitivity (see Additional data file for a detailed analysis and more results) Identifying yeast cell-cycle regulatory motifs To evaluate the performance of WordSpy on biological ... analysis, WordSpy can comprehensively identify real motifs from a large set of regulatory sequences with a high specificity Identifying Arabidopsis cell-cycle regulatory motifs Ce...

Ngày tải lên: 14/08/2014, 16:21

... identifying functional cis -regulatory elements …….140 7.3 Cooperativity and redundancy in cis -regulatory elements ……………….142 7.4 Conserved function of cis -regulatory elements in mammals and fish without ... validation of functionally significant variants and pathological mutations in the regulatory regions of the genome 1.4 Identification of cis -regulatory ele...

Ngày tải lên: 11/09/2015, 16:02

... regulatory questions in the actively multiplying tachyzoite, as any given population of cells in culture consists of parasites at different points of their cell cycle Our study reports the presence of ... a majority of the bases in each motif were substituted by base-specific transversions, thus destroying the original sequence of the candidate motif but maintainin...

Ngày tải lên: 14/08/2014, 21:20

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

... Kawaji H, Kasukawa T, Fukuda S, Katayama S, Kai C, Kawai J, Carninci P, Hayashizaki Y: CAGE Basic/Analysis Databases: the CAGE resource for comprehensive promoter analysis Nucleic Acids Res 2006, ... an integrated graphic development interface and tools for automatic SQL script generation and data exchange The wide array of PAZAR hostable datasets contains a great heterogeneity...

Ngày tải lên: 14/08/2014, 08:20

Ngày tải lên: 14/11/2014, 06:20

... overall incidence was found in Iceland and Japan and highest in USA and France The overall prevalence was the lowest in Northern Ireland, UK and Finland, and the highest in Italy, Spain and Martinique ... IDENTIFICATION AND CHARACTERIZATION OF A NOVEL HEART- REACTIVE AUTOANTIBODY IN SYSTEMIC LUPUS ERYTHEMATOSUS: POSSIBLE SEROLOGICAL MARKER FO...

Ngày tải lên: 14/09/2015, 12:42

... astrocytoma grades I, II [astrocytoma], III [anaplastic astrocytoma] and IV [glioblastoma or GM]), oligodendrogliomas, ependymomas and mixed gliomas Gliomas constitute 77% of the primary malignant brain ... the characterization of a glioblastoma specific promoter This study deals with the identification, isolation and characterization of a glioblastoma specific...

Ngày tải lên: 22/10/2015, 21:20

... aminoacids at the N-terminus of PHI (sequence: SKVYLALQDND) were compared with the sequences of the so called ‘intermediate components’ from two other PHs The N-terminal sequence of PHI from A radioresistens ... one PHR and one PHO (abc) protomer The hypothesis of a direct PHI phenol interaction is quite unlikely, because of the fact that the addition of ph...

Ngày tải lên: 21/02/2014, 00:20

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...

Ngày tải lên: 23/03/2014, 21:20

... 3.6 g of iron-oleate, 1.91 mL of oleylamine and 0.64 mL of oleic acid were mixed together and were heated at 120∘C for one hour After that, the dark solution was quickly heated up to 200∘C and ... CTAB;[16] and 0.5 mL of the resulting Fe3 O4 /CTAB aqueous solution were diluted with 10 mL of water Then 0.3 mL of NH4 OH aqueous solution, 0.03 mL of tetraethylorthosilicat...

Ngày tải lên: 14/05/2014, 15:49

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...

Ngày tải lên: 20/06/2014, 07:20

... doi:10.1186/1556-276X-7-60 Cite this article as: Gim et al.: Synthesis and characterization of integrated layered nanocomposites for lithium ion batteries Nanoscale Research Letters 2012 7:60 ... range of stoichiometric compositions Therefore, the present work reports on the synthesis and systematic investigations on the structure, morphology, and electrochemical p...

Ngày tải lên: 20/06/2014, 23:20