Growth and characterization of two dimensional carbon nanostructures

... of carbon before 2004 Nanotubes Graphite Sheets 1D 2D The most beautiful side of carbon Fullerene Amorphous Carbon 0D 3D The dark, soft and tough side of carbon The shining and hard side of carbon ... Structure of Two Dimensional Carbon 1.3 Carbon Nanowalls – Disordered 2D Carbon 1.3.1 Fabrication of Carbon Nanowalls 1.3.2 Structure and Morphology 11 1....

Ngày tải lên: 14/09/2015, 08:40

... ELECTRICAL CHARACTERIZATION OF TWODIMENSIONAL CARBON AND VO2 IN ULTRAHIGH VACUUM WANG YING (B Eng., Hons., National University of Singapore, Singapore) A THESIS SUBMITTED FOR THE DEGREE OF ... doping.115,116 Besides, trapped impurities between the insulating substrate and 2D carbon can also bring additional challenges to obtaining the intrinsic electronic properties...

Ngày tải lên: 08/09/2015, 15:25

... SPECTROSCOPIC STUDIES OF TWO DIMENSIONAL CARBON NANOSTRUCTURES AND SEMICONDUCTOR QUANTUM DOTS Ni Zhenhua (B Sc Shanghai Jiao Tong University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... results on spectroscopic studies of two dimensional carbon nanostructures: graphene and carbon nanowalls (CNWs) It also includes the high pressure Raman and...

Ngày tải lên: 13/09/2015, 21:36

... dissertation, the growth and characterization of nickel oxide (NiO) for various novel device applications are investigated In the aspect of growth, many methods of both solution-based and physical ... nanowires was demonstrated for the first time The applications of NiO thin films and nanostructures were then investigated for resistive switching memo...

Ngày tải lên: 09/09/2015, 10:07

... exploration of self-assembled synthesis and the possible applications of new Si and/ or Ge nanostructures and, (b) achieving a controlled growth of Si and Ge nanostructures 1.4 Organization of Thesis ... Abstract In this dissertation, the growth and characterization of five different types of germanium (Ge) and silicon (Si) nanostructures are presented Th...

Ngày tải lên: 11/09/2015, 10:04

... understanding of the physical and chemical properties of solid surface and interface is of great importance in many areas of science and technology, such as in material growth, chemical reactions and ... images of MnSb crystallites with diameter of (b) nm and (c) 15 nm 96 Fig 5.3 (a) Core-level XPS spectra of Mn 2p of MnSb nanoparticles with different d (b) Mn...

Ngày tải lên: 07/10/2015, 10:10

... vivo state of rainbow trout HSF1, however, it remains to be elucidated whether the HSF1 isoforms of rainbow trout form heterotrimers in vivo Why are there two isoforms of HSF1 in rainbow trout? Although ... of the heat shock response and beyond FASEB J 15 , 11 18 11 31 Mosser, D.D., Heikkila, J.J & Bols, N.C (19 86) Temperature ranges over which rainbow tr...

Ngày tải lên: 19/02/2014, 12:20

... process of soybean seeds as decreases in the mRNA levels of GmPDIL-1, GmPDIS-1 [26] and GmPDIM [27] were observed during the accumulation of the storage proteins Expression of certain seed storage proteins ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...

Ngày tải lên: 07/03/2014, 05:20

... identity with HvTrxh1 and HvTrxh2 are present in the TIGR barley sequence database As only HvTrxh1 and HvTrxh2 have been identied so far in the barley seed proteome, the other thioredoxin h isoforms ... endosperm and embryo show in detail how HvTrxh1 and HvTrxh2 are distributed in these tissues HvTrxh1 from all three tissues is observed The relative intens...

Ngày tải lên: 23/03/2014, 17:22

... growth and secreted AP activity of tomato suspension cells Tomato cells cultured for days in the absence of exogenous Pi had only approximately 40% of the fresh weight of the 8-day-old +Pi cells ... phosphoenolpruvate-hydrolyzing specific activity of 222 UÆmg)1 and a recovery of approximately 3%, whereas SAP2 was purified 50-fold to a final phosphoenolpruvate-hydrolyzing ac...

Ngày tải lên: 23/03/2014, 21:20

... doi:10.1186/1556-276X-6-187 Cite this article as: Potié et al.: Growth and characterization of gold catalyzed SiGe nanowires and alternative metal -catalyzed Si nanowires Nanoscale Research Letters 2011 ... mechanical characterization has also been carried out on Si and GaN NW for comparison SiGe NW growth First, the growth of SiGe NW using gold as c...

Ngày tải lên: 21/06/2014, 05:20

... citatsomreht a ot detcennoc )nedewS ,aicamrahP( tinu IIrohpitluM eht ni demrofrep saw sisylana citerohportcele ehT la te gnisucof cirtceleosi lacitylanA snoitacifidom thgils htiw ]42[ nibwoT fo dohtem ... ,BKL( rettolb yrd-imes tolBavoN a gnisu demrofrep saw sisylana tolbonummI la te gnittolbonummI ]31[ ilmmeaL yb debircsed snoitidnoc eht ot gnidrocca demrofrep saw siserohportcele dna ,selpma...

Ngày tải lên: 07/08/2014, 20:23

... Detection and characterization of two chimpanzee polyomavirus genotypes from different subspecies Virology Journal 2010 7:347 Submit your next manuscript to BioMed Central and take full advantage of: ... human McPyV and TSPyV, the orangutan polyomaviruses and LPV from African green monkeys Interestingly, both rodent viruses (MuPyV and HaPyV) also fall within this...

Ngày tải lên: 12/08/2014, 02:20

... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...

Ngày tải lên: 12/08/2014, 03:21

... SUMMARY Two- dimensional carbon materials including single and few layer graphene sheets are promising for spintronic applications due to their peculiar electronic properties, including small spin- orbit ... goal to build up a suitable interface to facilitate spin injection and transport in low dimensional carbon materials, and help realize energy efficient carbon...

Ngày tải lên: 10/09/2015, 09:11