Investigation of SPR and electrochemical detection of antigen with polypyrrole functionalized by biotinylated single chain antibody a review

... FT-IR spectra show the disappearance of the bands associated with pyrrolidinedione at 1818 and 1784 cm−1 , with the concomitant appearance of a new band at 1695 cm−1 characteristic of an amide function ... Talanta 74 (2007) 308–317 8 H.Q .A Lê et al / Analytica Chimica Acta 674 (2010) 1–8 [3] A Ramanavicius, A Ramanaviciene, A Malinauskas, Electrochimica Acta 51 (2006) 6...

Ngày tải lên: 13/09/2015, 18:05

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

... calculated quantities, Thin Solid Films 313314 (1998) 33 [6] R Swanepoel, Ellipsometry data for some thin film samples, J Phys E: Sci Instrum., 16 (1983) 1215 [7] Jobin-Yvon, Horiba Group Ellipsometry ... conditions (e.g the angle of polarization mirrors and modulators) and parameters of film (∆, Ψ) The measurement configuration is chosen for the purpose of simplifying the c...

Ngày tải lên: 28/03/2014, 13:20

... strategies used, but were found across levels of English This study aimed to explore listening strategies used by undergraduate students at four public universities in the south of Thailand to find ... bottom 10 strategies reported as being used by the students? Based on the mean scores of the frequency of each strategy item used by the su...

Ngày tải lên: 02/04/2014, 05:20

... practice Finally the fact that the validation was performed in a sample with at least two different types of life- changing diseases (cancer and MS, and other chronic diseases) and a healthy control ... With respect to age, the engagement in CRP increases with increasing age, while the engagement in a HuP decreases with increasing age Although not sign...

Ngày tải lên: 20/06/2014, 15:20

... Ethnobotanical investigation of ‘wild’ food plants used by rice farmers in Kalasin, Northeast Thailand Gisella S Cruz-Garcia1,2*§, Lisa L Price2,3* Centre for Crop Systems Analysis, Department of Plant ... diversity of plants found, contributing to the food and nutritional security of rice farmers in Kalasin, Northeast - 24 - Thailand The data compile...

Ngày tải lên: 10/08/2014, 09:22

... motor recording from the FHB, as well as the orthodromic medial and lateral plantar sensory values have acceptable intra-rater reliability and variability Acknowledgements The authors thank Amanda ... The motor latency, as well as the medial plantar latency and lateral plantar sensory amplitude and latency data was found to have a non-normal positively skewed...

Ngày tải lên: 10/08/2014, 21:24

... with the simplicity and advantageous arrangement of the retroviral genome, which has made retroviruses so attractive as vectors for gene therapy [11,12] The principal feature of the retroviral ... means that the major safety issue faced by those wishing to use retroviral vectors is that of insertional mutagenesis and oncogene activation Insertional mutage...

Ngày tải lên: 14/08/2014, 19:22

... Kojima, M., Oguro, K., Sawabe, K., Iida, Y. , Ikeda, R., Yamashita, A. , Nakanishi, N & Hasegawa, H (2000) Rapid turnover of tryptophan hydroxylase is driven by proteasomes in RBL2H3 cells, a serotonin ... Ichiyama, A. , Nakamura, S., Nishizuka, Y & Hayaishi, O (1970) Enzymic studies on the biosynthesis of serotonin in mammalian brain J Biol Chem 245, 1699–170...

Ngày tải lên: 08/03/2014, 16:20

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... genital disease in guinea pigs Effect of8 Effect of DL11 scFv on HSV-1 genital disease in guinea pigs Panel A: Blisters of GH days after instillation of HSV-1 into vaginal vault Se...

Ngày tải lên: 18/06/2014, 22:20

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... genital disease in guinea pigs Effect of8 Effect of DL11 scFv on HSV-1 genital disease in guinea pigs Panel A: Blisters of GH days after instillation of HSV-1 into vaginal vault Se...

Ngày tải lên: 20/06/2014, 04:20

... echocardiography during catheterization Severe aortic insufficiency is noted through the area of the left coronary cusp Aortic insufficiency is terminated by placement of catheter into left coronary cusp ... his operation was successful in preventing further events Page of doi:10.1186/1749-8090-5-94 Cite this article as: Martin et al.: Surgical management of life th...

Ngày tải lên: 10/08/2014, 09:22

... et al.: Targeting lentiviral vector to specific cell types through surface displayed single chain antibody and fusogenic molecule Virology Journal 2010 7:35 Submit your next manuscript to BioMed ... incorporated onto the lentiviral vector surface Having the targeting molecule more efficiently incorporated onto the vector surface could enhance the bi...

Ngày tải lên: 12/08/2014, 04:21

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

... used to analyse and evaluate the performance of a planar and a tubular-shaped PEM fuel cell 2.1 Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell ... conditions are specified at all external boundaries of the computational domain as well as boundaries for various mass and scalar equations inside the computationa...

Ngày tải lên: 05/09/2013, 14:58