0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Sinh học >

Investigation of SPR and electrochemical detection of antigen with polypyrrole functionalized by biotinylated single chain antibody a review

Investigation of SPR and electrochemical detection of antigen with polypyrrole functionalized by biotinylated single chain antibody  a review

Investigation of SPR and electrochemical detection of antigen with polypyrrole functionalized by biotinylated single chain antibody a review

... FT-IR spectra show the disappearance of the bands associated with pyrrolidinedione at 1818 and 1784 cm−1 , with the concomitant appearance of a new band at 1695 cm−1 characteristic of an amide function ... Talanta 74 (2007) 308–317 8 H.Q .A Lê et al / Analytica Chimica Acta 674 (2010) 1–8 [3] A Ramanavicius, A Ramanaviciene, A Malinauskas, Electrochimica Acta 51 (2006) 6025–6037 [4] (a) C Richad, ... pyBiotin/Streptavidin /Biotinylated Sc-Fv Ab/Casein) film at 0.1 V s−1 scan rate in PBS 10 mM, pH 7.4 3.3 Detection of antigen by electrochemical and SPR methods Antigen antibody reactions can be followed directly by...
  • 8
  • 760
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
  • 11
  • 679
  • 0
Báo cáo

Báo cáo "Investigation of zinc oxide thin film by spectroscopic ellipsometry " ppt

... calculated quantities, Thin Solid Films 313314 (1998) 33 [6] R Swanepoel, Ellipsometry data for some thin film samples, J Phys E: Sci Instrum., 16 (1983) 1215 [7] Jobin-Yvon, Horiba Group Ellipsometry ... conditions (e.g the angle of polarization mirrors and modulators) and parameters of film (∆, Ψ) The measurement configuration is chosen for the purpose of simplifying the calculation of trigonometry functions ... Ellipsometric data have been analyzed by Delta Psi software (Jobin – Yvon Co.) Fig shows ellipsometer spectra Is(λ), Ic(λ) of a ZnO film Transmission spectra of the sample were measured on a Jasco...
  • 8
  • 362
  • 0
An Investigation of English Listening Strategies Used by Thai Undergraduate Students in Public Universities in the South pdf

An Investigation of English Listening Strategies Used by Thai Undergraduate Students in Public Universities in the South pdf

... strategies used, but were found across levels of English This study aimed to explore listening strategies used by undergraduate students at four public universities in the south of Thailand to find ... bottom 10 strategies reported as being used by the students? Based on the mean scores of the frequency of each strategy item used by the subjects, the top 10 strategies used are presented in the table ... significance of listening and benefits of using the right strategies with the right tasks They can also serve as guidelines for teachers who would like to provide strategy training in English listening...
  • 17
  • 944
  • 5
báo cáo hóa học:

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

... practice Finally the fact that the validation was performed in a sample with at least two different types of life- changing diseases (cancer and MS, and other chronic diseases) and a healthy control ... With respect to age, the engagement in CRP increases with increasing age, while the engagement in a HuP decreases with increasing age Although not significant, it is remarkable that the lowest scores ... a patients SpR engagement The SpREUK questionnaire with its SpREUKP manual thus could be of value in measuring SpR attitudes and engagement of patients coping with life- threatening illness, and...
  • 11
  • 425
  • 0
Báo cáo y học:

Báo cáo y học: "Ethnobotanical investigation of ''''wild'''' food plants used by rice farmers in Kalasin, Northeast Thailand" ppsx

... Ethnobotanical investigation of ‘wild’ food plants used by rice farmers in Kalasin, Northeast Thailand Gisella S Cruz-Garcia1,2*§, Lisa L Price2,3* Centre for Crop Systems Analysis, Department of Plant ... diversity of plants found, contributing to the food and nutritional security of rice farmers in Kalasin, Northeast - 24 - Thailand The data compiled in this study shows that the majority of wild food ... importance of trees in rice fields in Northeast Thailand, documenting 52 trees found in the diverse farming systems in the rice landscape Finally, trees in rice fields have also been systematically documented...
  • 51
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: " Clinical utility of tibial motor and sensory nerve conduction studies with motor recording from the flexor hallucis brevis: a methodological and reliability study" pptx

... motor recording from the FHB, as well as the orthodromic medial and lateral plantar sensory values have acceptable intra-rater reliability and variability Acknowledgements The authors thank Amanda ... The motor latency, as well as the medial plantar latency and lateral plantar sensory amplitude and latency data was found to have a non-normal positively skewed distribution The motor latency ... participants The medial plantar sensory latency study also Page of demonstrated good reliability with an ICC value of 0.5 (P < 0.001) The lateral plantar sensory latency coefficient of variation...
  • 9
  • 327
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

... with the simplicity and advantageous arrangement of the retroviral genome, which has made retroviruses so attractive as vectors for gene therapy [11,12] The principal feature of the retroviral ... means that the major safety issue faced by those wishing to use retroviral vectors is that of insertional mutagenesis and oncogene activation Insertional mutagenesis and oncogene activation As ... that further efforts need to be made to assess and reduce the rate of transfer of retroviral genes Oncogene capture The mechanism of oncogene capture appears to be dependent on the generation of...
  • 13
  • 498
  • 0
Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

... Kojima, M., Oguro, K., Sawabe, K., Iida, Y. , Ikeda, R., Yamashita, A. , Nakanishi, N & Hasegawa, H (2000) Rapid turnover of tryptophan hydroxylase is driven by proteasomes in RBL2H3 cells, a serotonin ... Ichiyama, A. , Nakamura, S., Nishizuka, Y & Hayaishi, O (1970) Enzymic studies on the biosynthesis of serotonin in mammalian brain J Biol Chem 245, 1699–1709 Ichiyama, A. , Hasegawa, H., Tohyama, ... mastocytoma P-815 was readily phosphorylated by CaM kinase II Although the TPH from P-815 cells was easily phosphorylated by this kinase, its enzymic activity was not altered by the phosphorylation...
  • 9
  • 404
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... genital disease in guinea pigs Effect of8 Effect of DL11 scFv on HSV-1 genital disease in guinea pigs Panel A: Blisters of GH days after instillation of HSV-1 into vaginal vault Several areas of ... CCAAGCTGTGTCCTRTCC TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides:...
  • 10
  • 541
  • 0
báo cáo hóa học:

báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... genital disease in guinea pigs Effect of8 Effect of DL11 scFv on HSV-1 genital disease in guinea pigs Panel A: Blisters of GH days after instillation of HSV-1 into vaginal vault Several areas of ... CCAAGCTGTGTCCTRTCC TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides:...
  • 10
  • 401
  • 0
Báo cáo y học:

Báo cáo y học: "Surgical management of life threatening events caused by intermittent aortic insufficiency in a native valve: case report" ppsx

... echocardiography during catheterization Severe aortic insufficiency is noted through the area of the left coronary cusp Aortic insufficiency is terminated by placement of catheter into left coronary cusp ... his operation was successful in preventing further events Page of doi:10.1186/1749-8090-5-94 Cite this article as: Martin et al.: Surgical management of life threatening events caused by intermittent ... this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Author details Department of Pediatric Cardiology, Lucile...
  • 4
  • 308
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Targeting lentiviral vector to specific cell types through surface displayed single chain antibody and fusogenic molecule" pps

... et al.: Targeting lentiviral vector to specific cell types through surface displayed single chain antibody and fusogenic molecule Virology Journal 2010 7:35 Submit your next manuscript to BioMed ... incorporated onto the lentiviral vector surface Having the targeting molecule more efficiently incorporated onto the vector surface could enhance the binding of the vector to the cognate receptor on ... lentiviral vector (FUW/SC2H7-A2/SGN) was able to bind to 293T/CD20 cell line, but not to the control 293T cell line In contrast, the lentiviral vector FUW/VSVG was able to bind to both 293T and...
  • 12
  • 121
  • 0
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotubes and electroactive polymer ... works were related to label- free and reagentless biosensors Okuno et al (2007) described a label- free and reagentless immunosensor for prostate- specific antigen based on singlewalled CNT-modified...
  • 6
  • 298
  • 0
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell

... used to analyse and evaluate the performance of a planar and a tubular-shaped PEM fuel cell 2.1 Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell ... conditions are specified at all external boundaries of the computational domain as well as boundaries for various mass and scalar equations inside the computational domain 2.3.1 Inlets The inlet values ... (a) (b) Figure Three-dimensional computational domains of the planar and tubular-shaped PEM fuel cell: (a) planad and (b) tubular ISSN 2076-2895 (Print), ISSN 2076-2909 (Online) ©2013 International...
  • 26
  • 609
  • 0

Xem thêm

Từ khóa: synthesis and electrochemical performance of lifepo4 by solgel methodsynthesis and electrochemical performance of graphenepolyanilinesynthesis and electrochemical performance of graphenelike ws2prevention and early detection of anorexiaprevention and early detection of bulimiaprevention and early detection of cervical cancerBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ