Experimental and theoretical studies on adsorption chillers driven by waste heat and propane
Experimental and theoretical studies on adsorption chillers driven by waste heat and propane
... Introduction 1.1 Background 1.1.1 Heat Sorption Systems and Global Concerns on the Environment and Ecology 1.1.2 Limitations of Adsorption Chillers 1.1.3 Propane ... Choon Ng, and Wongee Chun "Pressurized Adsorption Cooling Cycles Driven by Solar /Waste Heat. " Applied Thermal Engineering (2014) Li, Ang, Ismail, Azhar Bin, Kyaw Thu, Kim Choon Ng, and Wai Soong ... saturation region for common working temperatures of evaporator and condenser Introduction 1.1.4 Review of Previous Studies on Adsorption Pairs In the literature, there have been extensive studies...
- 294
- 282
- 0
Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons 2
... 0.057 0. 128 0 .21 8 0.3 32 0.437 0.549 0.6 72 0.855 0.981 1.1 62 1.358 1.5 72 1.780 1.981 2. 2 02 2.4 12 0.0 12 0. 022 0.034 0.045 0.055 0.063 0.0 72 0.0 82 0.089 0.097 0.105 0.113 0. 120 0. 126 0.1 32 0.137 ... 0.143 0 .24 2 0.343 0.443 0.550 0.699 0.838 0.997 1 .20 5 1.401 1.601 1.799 2. 008 2. 207 2. 406 0.010 0. 022 0.0 32 0.041 0.049 0.057 0.066 0.074 0.0 82 0.091 0.099 0.106 0.1 12 0.118 0. 123 0. 128 Temperature=55 ... Temperature=45 ºC 0.0 62 0.157 0 .26 1 0.354 0.4 52 0.561 0.694 0.845 1.001 1 .20 6 1.414 1.6 02 1.804 2. 038 2. 230 2. 394 0.006 0.014 0. 021 0. 027 0.0 32 0.038 0.044 0.051 0.057 0.065 0.0 72 0.078 0.083 0.090...
- 13
- 194
- 0
Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons
... EXPERIMENTAL AND THEORETICAL STUDIES ON ADSORBED NATURAL GAS STORAGE SYSTEM USING ACTIVATED CARBONS KAZI AFZALUR RAHMAN (B.Sc in Mechanical Engineering, ... Saha, W.G Chun, K.C Ng, Theoretical modeling and simulation for adsorbed natural gas storage system using activated carbon, Proceedings of the 9th International Conference on Sustainable Energy ... operations due to the adsorption and desorption processes In this research, the ANG storage system is comprehensively studied both experimentally and theoretically for enhanced storage capacity and...
- 209
- 290
- 0
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx
... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction of endo-b-galactosidase from ... transglycosylation and time courses of the production of transglycosylation products and 10 from and degradation of (A) HPLC analysis was performed as described in Materials and methods (B) A reaction mixture...
- 11
- 365
- 0
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers
... Figure 5.40 Temperature profiles of major components of the waste- heat driven pressurized adsorption chiller with input heat flux of 2.75 W cm-2 147 Figure 5.41 Effects of operation time on chiller ... variation of the heat of adsorption as a function of loading, which in turn depends on the pressure and temperature at which adsorption/ desorption occurs The heat of adsorption, Qst can be measured experimentally ... Figure 5.13 Isosteric heat of adsorption for Maxsorb III-R507a 124 Figure 5.14 Isosteric heat of adsorption for ACF A20-R134a 124 Figure 5.15 Isosteric heat of adsorption for ACF A20-R507a...
- 221
- 831
- 0
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides
... semiconductor -based all- optical switches include semiconductor optical amplifier (SOA) and more recently silicon photonics Implementation of ultrafast silicon photonic switch is largely based on ... principles and switching operations of EUPT and EDPT 2.1.1 Energy-up photonic transistor based on AMOI scheme The all- optical operation of EUPT adopts the Absorption Manipulation of Optical Interference ... of transitions between optical and electrical domains, i.e Optical- toElectrical (OE) and Electrical-to -Optical (EO) or OEO conversions, which poses a lot of power consumption, space occupation,...
- 234
- 504
- 0
Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation
... studied: a) nonlinear capacitive line (NLCL) where only the capacitive component is nonlinear; b) nonlinear inductive line (NLIL) where only the inductive component is nonlinear; and c) nonlinear ... rise time of the output pulse and only a handful reported having done simulations for RF generation These simulations for RF generation not include resistive losses and the authors not show how ... Parametric Studies on NLETL 31 ix LIST OF FIGURES Figure 1.1 RF generation in NLETL Figure 1.2 Dispersion and nonlinear effects in NLETL Figure 2.1 Circuit diagram of a nonlinear lumped element transmission...
- 174
- 394
- 0
Theoretical and experimental studies on the promoting effect of boron on cobalt catalyst used for fischer tropsch synthesis
... THEORETICAL AND EXPERIMENTAL STUDIES ON THE PROMOTING EFFECT OF BORON ON COBALT CATALYST USED FOR FISCHER- TROPSCH SYNTHESIS (FTS) TAN KONG FEI (B Eng & M Phil., University of Malaya, ... Armando Borgna, Mark Saeys, Effect of Boron Promotion on the Stability of Cobalt Fischer- Tropsch catalyst , Journal of Catalysis, 280 (2011), 50 XX CHAPTER INTRODUCTION Fischer- Tropsch Synthesis ... 2010) The objective of this thesis is therefore to first understand the mechanism responsible for the deactivation of Co catalyst under realistic FTS conditions The deactivation of Co catalysts...
- 183
- 449
- 0
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps
... infection by inhibition of IFN signaling and blocking of the antiviral response [17] In this study we analyzed two variants of mumps virus V protein (VWT and VGly) derived from Urabe AM9 vaccine ... position 156 in the V protein (VGly) of HN-G1081 virus variant, whereas resistance to IFN was associated with preservation of wild-type phenotype in the V protein (VWT) of HN-A1081 Virus variant In the ... study we experimentally tested the interaction of VWT and VGly proteins of Urabe AM9 mumps virus variants with proteins of the IFN signaling pathway, finding differences in their capacity to...
- 10
- 311
- 0
Experimental and numerical studies on the viscoelastic behavior of living cells
... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... that the experimental methodology and theoretical model put forward in this thesis will contribute to a more accurate evaluation of the viscoelastic properties of cells and better understanding of...
- 191
- 275
- 0
Theoretical studies of engertics, structures and chemical reactions on carbon and BN surfaces and related molecules
... Theoretical Studies of Energetics, Structures and Chemical Reactions on Carbon and BN Surfaces and Related Molecules Abstract This thesis focuses on the energetics, structure and reactivity of wide band ... Theoretical Studies of Energetics, Structures and Chemical Reactions on Carbon and BN Surfaces and Related Molecules Yang Shuowang (B Sc & M Sc Zhejiang University) (M Sc NUS) A DISSERTATION ... types of BN crystals: h -BN, t -BN and c -BN h -BN and cBN are the most common structures The structure of h -BN is analogous to graphite The unit cell is bimolecular and consists of layers of flat...
- 183
- 271
- 0
Some experimental studies on vortex ring formation and interaction
... a Vortex Ring 3.5.4 Circulation of a Vortex Ring 63 65 65 67 67 3.6 Experimental Conditions 69 Chapter Results & Discussion 4.1 Circular Vortex Rings 4.1.1 Formation of the a Circular Vortex Ring ... interesting and complicated dynamics The third section reviews some past studies on the interaction of a vortex ring with a circular cylinder, and discussion on the cut -and- reconnection phenomena ... the boundary conditions affect not only the formation number, but also the formation characteristics and the structure of the vortex ring One such condition, which affects the formation characteristics,...
- 209
- 528
- 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB1 WhiB2 WhiB2 WhiB2 WhiB2 WhiB5 WhiB5 WhiB5 WhiB5 ... 90 90 75 60 60 45 30 30 15 WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 D 0h 2h 6h 20 h 30 h 42 h Effect of GSH (10 mM) WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 Effect of GSSG (10 mM) % Change in...
- 18
- 548
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
- 10
- 553
- 0
Từ khóa: epidemiological studies on antioxidants and cardiovascular diseasesynthesis spectral magnetic thermal and antimicrobial studies on symmetrically substituted 2cytogenetic studies on marine myodocopid ostracoda the karyotypes of gigantocypris dracontovalis cannon 1940 and macrocypridina castanea brady 1897experimental studies on the survival of pathogens in frozen foodssentence ordering driven by local and globalsentence ordering driven by local and global coherence for summary generationreview ten empirical studies on the impact of inflation on economic growth in nigeriaten empirical studies on the impact of inflation on economic growth in nigeriaa study on pronunciation errors made by fourth year students of english at vinh university and suggested solutionsresearch quantitative research comes in many approaches including descriptive correlational exploratory quasi experimental and true experimental techniquesresults of major studies on antiretroviral prophylaxis to prevent mother to child transmission of hivon off task support by way of the operating system on system x and blade serversstudies on homogeneous catalysis in scco2experimental and mathematical simulation of oxygen transport by hemoglobin based blood substituteexperimental and clinical evidencechuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM