Experimental and theoretical studies on adsorption chillers driven by waste heat and propane
... Introduction 1.1 Background 1.1.1 Heat Sorption Systems and Global Concerns on the Environment and Ecology 1.1.2 Limitations of Adsorption Chillers 1.1.3 Propane ... Choon Ng, and Wongee Chun "Pressurized Adsorption Cooling Cycles Driven by Solar /Waste Heat. " Applied Thermal Engineering (2014) Li, Ang, Ismail, Azhar Bin, Kyaw Thu, Kim Choon Ng, and Wai Soong ... s...
Ngày tải lên: 12/09/2015, 11:05
... 0.057 0. 128 0 .21 8 0.3 32 0.437 0.549 0.6 72 0.855 0.981 1.1 62 1.358 1.5 72 1.780 1.981 2. 2 02 2.4 12 0.0 12 0. 022 0.034 0.045 0.055 0.063 0.0 72 0.0 82 0.089 0.097 0.105 0.113 0. 120 0. 126 0.1 32 0.137 ... 0.143 0 .24 2 0.343 0.443 0.550 0.699 0.838 0.997 1 .20 5 1.401 1.601 1.799 2. 008 2. 207 2. 406 0.010 0. 022 0.0 32 0.041 0.049 0.057 0.066 0.074 0.0 82 0.091 0.099...
Ngày tải lên: 10/09/2015, 15:54
... EXPERIMENTAL AND THEORETICAL STUDIES ON ADSORBED NATURAL GAS STORAGE SYSTEM USING ACTIVATED CARBONS KAZI AFZALUR RAHMAN (B.Sc in Mechanical Engineering, ... Saha, W.G Chun, K.C Ng, Theoretical modeling and simulation for adsorbed natural gas storage system using activated carbon, Proceedings of the 9th International Conference on Sustainable Energ...
Ngày tải lên: 10/09/2015, 15:54
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx
... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction o...
Ngày tải lên: 31/03/2014, 07:20
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers
... Figure 5.40 Temperature profiles of major components of the waste- heat driven pressurized adsorption chiller with input heat flux of 2.75 W cm-2 147 Figure 5.41 Effects of operation time on chiller ... variation of the heat of adsorption as a function of loading, which in turn depends on the pressure and temperature at which adsorption/ desorption occurs The...
Ngày tải lên: 11/09/2015, 10:01
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides
... semiconductor -based all- optical switches include semiconductor optical amplifier (SOA) and more recently silicon photonics Implementation of ultrafast silicon photonic switch is largely based on ... principles and switching operations of EUPT and EDPT 2.1.1 Energy-up photonic transistor based on AMOI scheme The all- optical operation of EUPT adopts the Absorptio...
Ngày tải lên: 09/09/2015, 08:14
Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation
... studied: a) nonlinear capacitive line (NLCL) where only the capacitive component is nonlinear; b) nonlinear inductive line (NLIL) where only the inductive component is nonlinear; and c) nonlinear ... rise time of the output pulse and only a handful reported having done simulations for RF generation These simulations for RF generation not include resistive losses and...
Ngày tải lên: 10/09/2015, 09:26
Theoretical and experimental studies on the promoting effect of boron on cobalt catalyst used for fischer tropsch synthesis
... THEORETICAL AND EXPERIMENTAL STUDIES ON THE PROMOTING EFFECT OF BORON ON COBALT CATALYST USED FOR FISCHER- TROPSCH SYNTHESIS (FTS) TAN KONG FEI (B Eng & M Phil., University of Malaya, ... Armando Borgna, Mark Saeys, Effect of Boron Promotion on the Stability of Cobalt Fischer- Tropsch catalyst , Journal of Catalysis, 280 (2011), 50 XX CH...
Ngày tải lên: 10/09/2015, 15:51
báo cáo hóa học: " Correction: Experimental and theoretical studies of nanofluid thermal conductivity enhancement: a review" potx
Ngày tải lên: 21/06/2014, 02:20
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps
... infection by inhibition of IFN signaling and blocking of the antiviral response [17] In this study we analyzed two variants of mumps virus V protein (VWT and VGly) derived from Urabe AM9 vaccine ... position 156 in the V protein (VGly) of HN-G1081 virus variant, whereas resistance to IFN was associated with preservation of wild-type phenotype in the V protei...
Ngày tải lên: 12/08/2014, 01:22
Experimental and numerical studies on the viscoelastic behavior of living cells
... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR...
Ngày tải lên: 12/09/2015, 11:01
Theoretical studies of engertics, structures and chemical reactions on carbon and BN surfaces and related molecules
... Theoretical Studies of Energetics, Structures and Chemical Reactions on Carbon and BN Surfaces and Related Molecules Abstract This thesis focuses on the energetics, structure and reactivity of wide band ... Theoretical Studies of Energetics, Structures and Chemical Reactions on Carbon and BN Surfaces and Related Molecules Yang...
Ngày tải lên: 17/09/2015, 17:18
Some experimental studies on vortex ring formation and interaction
... a Vortex Ring 3.5.4 Circulation of a Vortex Ring 63 65 65 67 67 3.6 Experimental Conditions 69 Chapter Results & Discussion 4.1 Circular Vortex Rings 4.1.1 Formation of the a Circular Vortex Ring ... interesting and complicated dynamics The third section reviews some past studies on the interaction of a vortex ring with a circular cylinder, and discussion on...
Ngày tải lên: 16/10/2015, 15:36
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20