Characterization of wip1 function in tumourigenesis

... signaling Introduction 1.2 The function of Wip1 1.2.1 The characterization of Wip1 In 1997, PP2Cδ was initially identified by Fiscella and colleagues as Wip1, wild-type p53-induced phosphatase 1, in ... formation in the presence of the ApcMin mutation, suggesting that Wip1 is critical in regulating ApcMin-driven polyposis (Demidov et al., 2007a) In Wip1- deficient...

Ngày tải lên: 12/09/2015, 09:59

... 1.1.3.1 Pin1 function in M phase 1.1.3.2 Pin1 function in G1 and S phase 1.1.3.3 Pin1 function in oncogenesis .9 1.1.4 Pin1 function in apoptosis 10 1.1.5 Pin1 function in ... reduction of zPin1 expression in zPin1 morphant embryos 79 Figure 3.8 Developmental delay in zPin1 morphant embryos 82 Figure 3.9 Neurogenin1 staining of the wild type embryos and c...

Ngày tải lên: 12/09/2015, 09:55

... drawing of the TJ proteins TJ proteins consist of TM proteins and plaque proteins that link TM proteins to the cytoskeleton (Johnson LG 2005) 16 TM proteins of TJ The three most common TM proteins ... cytoskeleton proteins Some scaffolding TJ proteins lacking PDZ domains such as cingulin can also link integral proteins to the actin cytoskeleton, whereas other...

Ngày tải lên: 11/09/2015, 16:04

... residue in the N-terminal part of the peptide that binds in the with the C-terminal domain in CaM However in PhK5 Trp357 is found at the C-terminal end of the peptide This suggests that either PhK5 ... occurring on binding of the peptide and could indicate that the binding of PhK5 to Ca2+⁄ CaM is similar to that observed for Ca2+⁄ CaM binding to i...

Ngày tải lên: 19/02/2014, 17:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and...

Ngày tải lên: 16/03/2014, 13:20

... DISCUSSION The findings in this study show that GR is highly expressed in epithelial cells of the male genital tract, especially in the Ó FEBS 2002 Glutathione reductase in male reproduction system ... level of expression of aldose reductase was also detected in the epithelia of the male genital tract In addition, glutathione S-transferase is pre...

Ngày tải lên: 17/03/2014, 17:20

... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] su...

Ngày tải lên: 22/03/2014, 21:21

... arginine may affect the secondary structure of the C-terminal tail and the binding of H1.4 to chromatin, as arginine offers additional hydrogen-bonding abilities to DNA as compared to lysine ... cell lines was extracted by using the DneasyTM tissue kit (Qiagen, Hilden, Germany) and examined for sequence variations in codon 18 of H1.2 and in codon 174 of H1.4 To obt...

Ngày tải lên: 30/03/2014, 20:20

... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...

Ngày tải lên: 18/06/2014, 19:20

... the measles genotype circulating in China in 2004 and to complement the database of genetic characteristics of China measles strains during the control phase of the disease Table 1: Number of ... [8,27-29] Since WPRO, including China, has recently initiated a program to eliminate measles in 2012, maybe a variety of genotypes will be detected in China as the intensi...

Ngày tải lên: 20/06/2014, 01:20

... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...

Ngày tải lên: 20/06/2014, 03:20

... processing She has published a number of proceedings papers and papers on medical image processing and tissue characterization Automatic Characterization of Myocardial Perfusion in Contrast Enhanced ... the intensity of the CM In our opinion, the use of 3D analysis of myocardial perfusion MRI in clinical environment requires both an improvement in MR device...

Ngày tải lên: 23/06/2014, 01:20

... diester-P in the clay and silt fractions from mineralization and explain the higher diester proportion observed in VR and NF soils than in SM and FG (table IV) with higher amounts of these fine fractions ... these forest soils that an increase of the rainfall causes a decrease of the quality of SOM as a consequence of decreasing the pH and increasing of free...

Ngày tải lên: 08/08/2014, 14:21

... Srinivasan L, Thara R, Tirupati SN: Cognitive dysfunction and associated factors in patients with chronic schizophrenia Indian J Psychiatry 2005, 47:139-143 Ananthanarayanan CV, Janakiramaiah N, Gangadhar ... Scale) – A Scale for Measuring and Quantifying Disability in Mental Disorders Chennai: Indian Psychiatric Society; 2002 American Psychiatric Association: Diagnostic and...

Ngày tải lên: 08/08/2014, 23:20