Characterization of TROM, a novel transcription repressor in human cancers identified by modified suppression subtractive hybidization (MSSH)

... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm of ... 2000;165(2):1153-9 52 Ohminami H, Yasukawa M, Kaneko S, Yakushijin Y, Abe Y, Kasahara Y, et al Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4(+) Tcell clon...

Ngày tải lên: 12/09/2015, 09:59

... proteins, protein kinases and phosphatases Actin binding proteins that localize at FA sites include talin, tensin, paxillin, vinculin and α-actinin (Yam, et al., 2009) The assembly of FAs can be induced ... and adaptor proteins in focal adhesion complexes There are 25    four main signaling pathways activated by integrins that are relevant to angiogenesis: Ras-mitogen-activated protei...

Ngày tải lên: 14/09/2015, 08:25

... lamellae and EGC-like cells of the primary lamellae of red sea bream gills We are currently trying to obtain cDNAs encoding chrysophsins from the gills of red sea bream, and we aim to investigate the ... (minimal lethal concentration) of native and synthetic chrysophsins compared with that of magainin-2 Minimal lethal concentrations of peptide are given...

Ngày tải lên: 23/03/2014, 20:22

... within negatively stained particles of artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase ... denaturation Artemin, apoferritin and ferritin protected citrate synthase against denaturation at 43 °C in a concentrationdependent manner (Fig 3A C) Maximal protec...

Ngày tải lên: 16/03/2014, 11:20

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and ... Ovarya Peripheral blood leukocytea Prostatea Small intestinea Spleena Testisa Thymusa Bone marrowa Fetal livera Lymph nodea Tonsila Breastb Lungb Milk cellsa Bovine Mammary glandc Mammary glan...

Ngày tải lên: 24/03/2014, 04:21

... from Uehara Memorial Foundation and International Society of Heart and Lung Transplantation (AS) Lists of abbreviations AFAP: actin filament associated protein; AFAP1L2: actin filament associated ... understanding of these mechanisms Binding Partner pY PI3K Src inactive XB130 pY pY Binding Partner active tyrosine kinase-mediated signaling transcriptional activation Cell cycle Survival M...

Ngày tải lên: 10/08/2014, 09:22

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra)...

Ngày tải lên: 10/09/2015, 08:37

... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... HexNAc1ÆHex5ÆHep4ÆAnKdo-ol (Tables and 4) The Table Negative ion ESI-MS data and proposed compositions for O-deacylated lipopolysaccharide (LPS-OH) of nontypeable Hae...

Ngày tải lên: 08/03/2014, 02:21

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... the yeast deubiquitinating enzyme Ubp16, a metalloprotease belonging to the large family of deubiquitinating enzymes, mainly consisting of cysteine proteases [43] Another class of p...

Ngày tải lên: 07/03/2014, 16:20

... than the activity in the precipitate from the Ca1 transfected cells demonstrating that the Cb2 antibody in combination with PKA kinase assay could be used to detect specifically Cb2 activity To ... PKA- specific kinase activity, as shown in Fig 4B This demonstrated that precipitates extracted with 8-CPTcAMP contained cAMP-inducible PKA activity that could be inhibited by protein kina...

Ngày tải lên: 16/03/2014, 18:20

... D-Ala-D-Ala, incubated at 37 °C for 30 min, and assayed for D,D-dipeptidase activity using the D-amino acid oxidase assay Kinetic analysis of VanXYC His6–VanXYC (2.25 · 10)7 M) was incubated at ... D-Ala-D-Ala with minimal activity against D-Ala-D-Ser, a very different type of specificity VanXYC, VanX-type and VanY-type enzymes contain most of the active site residues identified...

Ngày tải lên: 18/03/2014, 01:20

... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-D...

Ngày tải lên: 30/03/2014, 04:20

... Stains-all staining; lane C, negative staining; lane D, Methyl green staining Arrows on the right side of the lanes indicate the position of the 52 kDa component A weakly stained band in lane A ... pellet at approxi2978 Fig SDS ⁄ PAGE electrophoretogram of GISM in the OM of C nippona The same amount of sample was applied to each lane Lane M, molecular mass stan...

Ngày tải lên: 30/03/2014, 04:20

... V) reverse bias In this paper, we report the fabrication of ZnO UV sensor consisting of ZnO micro spheres in a matrix of nanowires Experimental ZnO sheets consisting of spheres in nanowires were ... enlarged images in Fig 3(c) and (d) reveal the network of nanowires that are 30–65 nm in diameter and a few microns in length In an attempt to understand th...

Ngày tải lên: 22/06/2014, 22:20