Proteomic characterization of novel protein protein interactions for understanding functions of gene products
... tool for the identification and isolation of potential interacting protein partners for your protein of interest The knowledge requirement for your protein of interest is only very minimal If a protein ... time the corresponding gene is cloned Last but not least, modification of this system has allowed for studies of protein- DNA and protein- RNA interactions K...
Ngày tải lên: 12/09/2015, 08:19
... http://www.translational-medicine.com/content/7/1/75 Figure Protein Tyrosine Kinase and other Major Kinases involved in Angiogenic Pathways Protein Tyrosine Kinase and other Major Kinases involved in Angiogenic ... serine-threonine kinases, lipid kinases, adhesion molecules and other diffusible signaling proteins The abundance of multiple PTKs and other kinase...
Ngày tải lên: 18/06/2014, 15:20
... expression data with protein- protein interactions Genome Res 2002, 12:37-46 Rhodes DR, Tomlins SA, Varambally S, Mahavisno V, Barrette T, Kalyana-Sundaram S, Ghosh D, Pandey A, Chinnaiyan AM: Probabilistic ... three analyzed HeLa cell-cycle datasets AP2, adaptor-related protein complex 2; APC, anaphase promoting complex; ARC, axin related complex; ATP_F0, ATP synthase, H+ transporting, m...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo khoa học: Proteomic characterization of lipid raft proteins in amyotrophic lateral sclerosis mouse spinal cord pot
... same mouse; and (b) the protein was consistently identified in the independent Fig Evaluation of the isolation of lipid raft proteins Lipid raft proteins were isolated from spinal cords of symptomatic ... Metabolism AATM _MOUSE CHP1 _MOUSE CD81 _MOUSE CDC42 _MOUSE CAH2 _MOUSE DHPR _MOUSE ALDOC _MOUSE LDHB _MOUSE MDHM _MOUSE MBP _MOUSE MYP0 _MOUSE SIRT2 _MOUSE...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo y học: "proteomic characterization of non-small cell lung cancer in a comprehensive translational thoracic oncology database" docx
... Cite this article as: Surati et al.: Proteomic characterization of non-small cell lung cancer in a comprehensive translational thoracic oncology database Journal of Clinical Bioinformatics 2011 ... staining of one core of a TMA to that of a control core on the same slide A score of indicates faint staining, indicates medium intensity staining, and indic...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: "Proteomic characterization of iron deficiency responses in Cucumis sativus L. roots" pot
... localization of phosphoenolpyruvate carboxylase in developing and germinating wheat grains Plant Physiol 1998, 116:1249-1258 52 Neuhoff V, Arold N, Taube D, Ehrhardt W: Improved staining of proteins in ... Figure reports the changes in the relative spot volumes of proteins that were increased in quantity under Fe deficiency For most of the proteins there was an increasing tr...
Ngày tải lên: 11/08/2014, 11:21
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... to the 9th cycle from the N-terminus including the initiating Met: MHKTHSTMS for Sno1p and MTGEDFKIKS for Snz1p Properties of the complex of Sno1p and Snz1p When Sno1p with a His-tag and Snz1p ... SNO3, SNZ2 and SNZ3 complement the defect The relationship of all of these genes remains to be clarified Expression and purification of Sno1p and Snz1p In light...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... initiation codon, using the primer 5'-TGCAAATAAATGGATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000) Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA3' (nt 6113 to 6134) and 5'-TATCAACCCCAGCTAAGTAAGCAA-3' ... 42:1057-1066 Haziza B, Chauvin JP, Gluschankof P, Suzan M: Caprine arthritis encephalitis virus: evidence for a B/D-type assembly pathway in a C-type lentivirus replication Virology...
Ngày tải lên: 13/08/2014, 06:20
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering dis...
Ngày tải lên: 12/09/2015, 08:20
Isolation and characterization of aurora a kinase interacting protein (AKIP), a novel negative regulator for aurora a kinase
... Hypothesis of Possible Anti-Tumour Role of AKIP-mediated UbIndependent Degradation of Aurora- A, 234 ix Abbrevations aa A Box AD ADH AIK1 AKIP ALLM ALLN AML Amp APC/C ATP AURKA AZ AZI amino acid Aurora ... yeast and successfully isolated a novel negative regulator of Aurora- A kinase, named as AKIP (Aurora- A Kinase Interacting Protein) AKIP is an ubiquitous...
Ngày tải lên: 14/09/2015, 22:15
Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc
... Gevaert et al COFRADIC and protein modifications analysis of purine-binding proteins in a total lysate of human Jurkat T-cells [40] primary separation mAU 1400 COFRADIC analysis of protein processing ... [34,36] and N-glycosylation [39] – and describe the use of COFRADIC for studying interactions between small molecules and proteins The latter is a particular applicatio...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: The conformational stability of the Streptomyces coelicolor histidine-phosphocarrier protein Characterization of cold denaturation and urea–protein interactions doc
... (enzyme I of the PTS), the rst protein in the cascade of proteins forming the PTS, to HPr, the histidine-phosphocarrier protein HPr is the smallest protein in the protein cascade of the PTS and it ... (see above) Discussion The conformational stability and the cold- denaturation of scHPr The conformational stability of a protein, DG, i...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Mesoscopic Model for Mechanical Characterization of Biological Protein Materials docx
... topology of protein structure is responsible for mechanical properties of protein crystals MODELS MESOSCOPIC MODEL FOR BIOLOGICAL PROTEIN MATERIALS We assume that the mechanical response of biological ... mechanical characterization of protein materials may allow for gaining insight into the biological functions of mechanical proteins Mechanica...
Ngày tải lên: 22/02/2014, 08:20
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... process of soybean seeds as decreases in the mRNA levels of GmPDIL-1, GmPDIS-1 [26] and GmPDIM [27] were observed during the accumulation of the storage proteins Expression of certain seed storage proteins ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...
Ngày tải lên: 07/03/2014, 05:20