Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion,...

Ngày tải lên: 12/09/2015, 08:18

... diabetes and cancer and the diabetes groups A significantly larger proportion of patients reported being inactive and having less than a secondary education in the comorbid diabetes and cancer and ... Canadian Diabetes Association, the Heart and Stroke Foundation of Canada, The Kidney Foundation of Canada, theCIHR – Institute of Nutrition, Metabolism and...

Ngày tải lên: 20/06/2014, 15:20

... immunodeficiency virus type in human placental trophoblasts Journal of Virology 2004, 78:11904-11915 Vidricaire G, Tremblay MJ: A clathrin, caveolae, and dynaminindependent endocytic pathway requiring free ... immunodeficiency virus type J Gen Virol 1991, 72(Pt 6):1253-1260 Vidricaire G, Imbeault M, Tremblay MJ: Endocytic host cell machinery plays a dominant role in intracellular tr...

Ngày tải lên: 12/08/2014, 23:21

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate...

Ngày tải lên: 21/02/2014, 20:20

... regions of the state On the other hand, only a small fraction of those claiming the tax credit take advantage of the low-interest loan Furthermore, the property-tax exemption complements the ... National Laboratory, Matthew Brown of the National Conference of State Legislatures, Jane Weissman of the Interstate Renewable Energy Council, Frederick Beck of...

Ngày tải lên: 06/03/2014, 19:20

... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP...

Ngày tải lên: 07/03/2014, 03:20

... 2020–2025.22 The growing of the aging ­ opulation Healthy Aging & Clinical Care in the Elderly 2010:2 Functional health status of the elderly in Taiwan will require equivalent increase in health care ... measurable indicators that reflect all levels of their daily functioning The tool used in the Healthy Aging & Clinical Care in the Elderly 2010:2...

Ngày tải lên: 14/03/2014, 20:20

... above, these initial conditions were rapidly conducive to steady conditions where and were present in very similar concentrations, and the rates of the forward reaction (conversion of to 3) and the ... Discussion The main part of the present study was a search, under conditions of maximal stringency, for fragment exchange that could be the hallmark of the hypothetical...

Ngày tải lên: 16/03/2014, 06:20

... compilation ª 2009 FEBS 2101 Interaction of EW29Ch with sugars H Hemmi et al constants by NMR to analyze the interaction between the protein and lactose in a solution state As mentioned above, one of ... affect the dissociation constants By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the fast exchange regime, Kd value...

Ngày tải lên: 23/03/2014, 04:21

Ngày tải lên: 07/08/2014, 17:22

Ngày tải lên: 07/08/2014, 17:22

... populations in Europe [17, 20] It is bivoltine [23]; in this study its overwintering generation was associated with P tabaniformis Parasitoids of P tabaniformis in Sofia During the years of investigation, ... investigation, parasitoids destroyed a significant portion (32.5–55.6%) of overwintering larvae of P tabaniformis in Sofia No studies have been conducted on t...

Ngày tải lên: 08/08/2014, 14:21

... during genistein incubation and the incubation with higher genistein doses Mechanisms of interaction To search for mechanisms of interaction we investigated protein expression of cell cycle controlling ... with genistein 10 μM and irradiation with Gy together, the effects of genistein on survival in these cell lines seem to be independent of ER- and p...

Ngày tải lên: 09/08/2014, 09:22

... first on- farm estimation of genetic parameters for dairy traits (milk yield and composition) in milking ewes The present estimates were generally consistent with those obtained in dairy cows for ... variabilities of fat and protein matter and for genetic correlations between matter yields and milk yield, between milk yield and both contents, be...

Ngày tải lên: 09/08/2014, 22:22