Establishment of cell polarity in zebrafish role of staufen and GRB2 in cell migration

Establishment of cell polarity in zebrafish  role of staufen and GRB2 in cell migration

Establishment of cell polarity in zebrafish role of staufen and GRB2 in cell migration

... understanding of cell polarity in a global perspective This thesis addresses the function of two proteins namely Staufen and Grb2, in controlling the migration of cells 1.2 Cell polarity in unicellular ... Implications of Staufen proteins in mRNA binding and localization 115 5.1.2 Are Staufen proteins required for specification of axis and patterning?...

Ngày tải lên: 12/09/2015, 08:18

179 285 0
Localized molecules and the establishment of polarity in zebrafish

Localized molecules and the establishment of polarity in zebrafish

... to the leading edge and delocalization of actin transcripts could result in loss of polarity in these cells (Condeelis and Singer, 2005) 1.1.5 Polarity in Xenopus oocytes In vertebrates, the ... essential in frog eggs for the formation of the dorsal organizer GSK3 binding protein GBP is required on the dorsal side to inhibit the activity of the GSK3 an...

Ngày tải lên: 15/09/2015, 17:09

180 271 0
Báo cáo y học: " Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos" pptx

Báo cáo y học: " Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos" pptx

... Lu et al.: Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos Journal of Biomedical Science 2011 18:73 Submit your next ... proliferation in vitro [30] Our results revealed tbx5 insufficiency ultimately resulted in activation of apoptosis and inhibition of cell growth...

Ngày tải lên: 10/08/2014, 10:20

10 592 0
Báo cáo y học: " Successful establishment of primary small airway cell cultures in human lung transplantation" doc

Báo cáo y học: " Successful establishment of primary small airway cell cultures in human lung transplantation" doc

... Y Nδ Nδ Y Y Nγ Nγ Y Y Y Nγ Y Nγ Nγ Y Y Y Y Y Y Y Y Y Y Y Y LAEC Y Y Y Nα Y Nγ Nγ Y Y Y Nγ Y Nγ Y Y Y Y Y Y Y Y Y Y Y Y Y SAEC Nγ Y Y Y Nδ Nδ Y Y Y Y Y Nβ Y Y Y Y Y Y - LAEC Nγ Y Y Y Y Y Y Y Y ... Y Y Y Y Y Y Y Y Nβ Y Y Nγ Y Y Y - SAEC Y Y Y Nδ Y Y Y Y Nγ Y - LAEC Y Y Y Y Y Y Y Y Nγ Y - SA...

Ngày tải lên: 12/08/2014, 14:20

10 352 0
Báo cáo sinh học: " Establishment of stable Huh-7 cell lines expressing various hepatitis C virus genotype 3a protein: an in-vitro testing system for novel anti-HCV drugs" potx

Báo cáo sinh học: " Establishment of stable Huh-7 cell lines expressing various hepatitis C virus genotype 3a protein: an in-vitro testing system for novel anti-HCV drugs" potx

... NS2-IAS CCTCACGGCCTAATCGTGC EcoR1 NS4A-IS AGCACCTGGGTGTTGCTC 576 Hind III NS4A-IAS GCACTCCTCCATCTCATCGT EcoR1 NS4B-IS TCACAAGCTGCCCCATATATCG Hind III 10 NS4B-IAS GCTACAAGGGCTTGGGTAGTC Xba1 642 ... CORE-IS ATGAGCACACTTCCTAAACCTCA Hind III CORE-IAS ACTGGCTGCTGGATGAATTAAGC EcoR1 Hind III E1-IS CTAGAGTGGCGGAATACGTCTG E1-IAS GGCGACCCCTGAGAACATAACC EcoR1 NS2-IS CTTTGGTCCCTAGCATTGC No of Nucleotid...

Ngày tải lên: 14/08/2014, 19:22

6 321 0
the role of wasp family members in dictyostelium discoideum cell migration

the role of wasp family members in dictyostelium discoideum cell migration

... by the inclusion of profilin and αactinin The role of these proteins in promoting actin nucleation and maintaining actin treadmilling is summarised in figure 1.1c How these factors and many others ... remains the focus of ongoing research 1.3.4 Regulation of the WASP family WASP family members are regulated by Rho -family GTPases Members of this subfamily...

Ngày tải lên: 22/12/2014, 18:48

213 536 0
Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions

Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions

... on their functions can divide T cells into T helper cells, cytotoxic T cells and regulatory T cells 1.2.1 T helper (TH) Cells There are four basic types of THelper cells: THelper1, THelper2, THelper17 ... different subset of immune cells into the lymphoma tissues, HRS cells are also able to modulate the phenotype of specific immune cells into subset that could co...

Ngày tải lên: 10/09/2015, 09:29

204 400 0
Genetic analysis of the role of ARP2 3 complex in border cell migration in drosophila melanogaster

Genetic analysis of the role of ARP2 3 complex in border cell migration in drosophila melanogaster

... polyproline sequences and interacts with profilin (Chang et al 1997) Since profilin binds to actin monomer, FH1 domains can bind the profilin-G-actin 13 Arp2/ 3 complex in border cell migration ... actin assembly In Drosophila, the Arp2/ 3 complex functions in actin dynamics together with SCAR/WAVE and WASP proteins The Drosophila Arp2/ 3 complex and SCAR/...

Ngày tải lên: 10/09/2015, 15:48

133 355 0
Hedgehog signaling in the zebrafish embryo  role of kif7 and DZIP1 1

Hedgehog signaling in the zebrafish embryo role of kif7 and DZIP1 1

... Phosphoinositide Pathway 1. 10 Aim of Thesis 6 7 9 10 11 12 13 14 16 16 19 19 19 21 21 26 26 28 28 30 31 32 ii Chapter Materials and Methods 2 .1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 2 .10 2 .11 2 .12 2 .13 ... Hedgehog 1. 3.4 Regulation of Smoothened Activity 1. 4 Activation of Hedgehog protein 1. 5 Comparing Hedgehog Orthologs 1. 5 .1 Patched 1. 5.2 Smoothened...

Ngày tải lên: 10/09/2015, 15:49

10 319 0
Hedgehog signaling in the zebrafish embryo  role of kif7 and DZIP1 2

Hedgehog signaling in the zebrafish embryo role of kif7 and DZIP1 2

... kinesin-like protein of 1363 amino acids was assembled Like Drosophila Cos2 and other members of the kinesin heavy chain (KHC) superfamily of proteins, the N-terminal and C-terminal regions of ... about the mechanism of the pathway The aim of this study focuses on two proteins, Cos2 /Kif7 and Iguana /Dzip1 Drosophila Cos2 plays an important role in Hh signal...

Ngày tải lên: 10/09/2015, 15:49

132 339 0
Role of stat3 in cell migration

Role of stat3 in cell migration

... Role of STAT3 in cell migration under physiological conditions 25 1.10.2 Role of Stat3 in cell invasion and metastasis 27 1.10.3 Cytoplasmic role of Stat3 in regulating microtubules 28 1.11 Cell ... how Stat3 regulates cell migration In this study, we used Stat3- deficient and wild type Stat3- expressing murine embryonic fibroblasts as a model to inve...

Ngày tải lên: 11/09/2015, 16:06

170 207 0
Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma

Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma

... 3 .1. 1 Cloning of C-terminal Fat1 30 3 .1. 2 Cloning of C-terminal Atrophin1 31 3 .1. 3 Blue white colony screening 32 3.2 33 Subcloning Of Fat1 and Atrophin1 3.2 .1 Touch up PCR for Fat1 and Atrophin1 ... understanding the roles of Fat1 and Atrophin1 in the mechanism of regulation in planar cell polarity MBD1 or Methyl binding domain protein belon...

Ngày tải lên: 05/10/2015, 22:31

92 1,3K 0
 Circuit theory of finance and the role of incentives in financial sector reform

Circuit theory of finance and the role of incentives in financial sector reform

... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...

Ngày tải lên: 24/10/2012, 09:33

55 666 0
Establishment of Effluent Standards for Industrial Wastewaters in Korea: Current Issues and Suggestions for Future Plan

Establishment of Effluent Standards for Industrial Wastewaters in Korea: Current Issues and Suggestions for Future Plan

... the current state of effluent standards in Korea and the considerations to be used in revising effluent standards and the framework referring to the cases of developed countries The purpose of ... changed in setting the effluent standards Table - Pollutants regulated under the effluent standards in Korea (Ministry of Government Legislation in Korea, 200...

Ngày tải lên: 05/09/2013, 10:15

15 543 0
Prediction of deformation and hygro-thermal stresses distribution in PEM fuel cell vehicle using threedimensional CFD model

Prediction of deformation and hygro-thermal stresses distribution in PEM fuel cell vehicle using threedimensional CFD model

... effect of hygro-thermal stresses into actual three-dimensional fuel cell model This model is used to investigate the hygro and thermal stresses in PEM fuel cell, which developed during the cell ... model of a PEM fuel cell has been developed to simulate the hygro and thermal stresses in PEM fuel cell, which are occurring during the cell operat...

Ngày tải lên: 05/09/2013, 14:58

20 385 0
w