Roles of RUNX3 as a tumor supressor protein

Roles of RUNX3 as a tumor supressor protein

Roles of RUNX3 as a tumor supressor protein

... intracellular Ca2+ release that activates protein kinase C and Ca2+/calmodulindependent kinase II, which in turn activates TAK1 mitogen-activated protein kinase (MAPK) kinase kinase and nemo-like kinase ... of gastric cancer and other cancers Besides playing a role as a gastric cancer tumour suppressor, RUNX3 is also thought to be involved in a diverse range of cancers and p...

Ngày tải lên: 11/09/2015, 16:06

248 194 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx

Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx

... monitored after each addition of the aliquot, and plotted against the amounts of hemin added [24] Molecular properties of adrenal inner zone antigen Osaka, Japan) The strength of the magnetic field was ... purchased from Takara (Kyoto, Japan) and Toyobo (Osaka, Japan), respectively QuikChange XL Site-Directed Mutagenesis Kit was from Stratagene (La Jolla, CA, USA) Constructio...

Ngày tải lên: 30/03/2014, 11:20

12 351 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

... selenocysteine metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y. , Hayashi, T., Tanaka, A. , Watanabe, Y. , Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an ... 2002 Selenoprotein P as a selenium supply protein (Eur J Biochem 269) 5747 provided by Ajinomoto, Co Inc., Kawasaki, Japan Human serum albumin and human outdated frozen...

Ngày tải lên: 31/03/2014, 08:20

6 371 0
Báo cáo y học: "High mobility group box-1 protein as a tumor necrosis factor-independent therapeutic target in rheumatoid arthritis." ppsx

Báo cáo y học: "High mobility group box-1 protein as a tumor necrosis factor-independent therapeutic target in rheumatoid arthritis." ppsx

... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays ... GallowitschPuerta M, Patel NB, Huston BJ, Chavan S, Rosas-Ballina M, Gregersen PK, Czura CJ, Sloan RP, Sama AE, Tracey KJ: Cholinergic anti-inflammatory pathway activity and high mobility g...

Ngày tải lên: 09/08/2014, 10:23

2 361 0
Báo cáo y học: "Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor" pdf

Báo cáo y học: "Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor" pdf

... SY, Yan J, Hataya T, Kimura I, Shikata E: Rice ragged stunt Oryzavirus genome segment encodes a 38,600 Mr structural protein J Gen Virol 1995, 76:975-978 11 Upadhyaya NM, Ramm K, Gellatly JA, ... procedure and RNA segments of Rice ragged stunt virus Ann Phytopathol Soc Jpn 1983, 49:670-675 Miyazaki N, Uehara-Ichiki T, Xing L, Bergman L, Higashiura A, Nakagawa A, Omura T, Cheng RH: Str...

Ngày tải lên: 12/08/2014, 02:20

6 309 0
Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

... Distant metastasis Presence of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step ... Hou Q, Tan HT, Lim KH, Lim TK, Khoo A, Tan IB, Yeoh KG, Chung MC Identification and Functional Validation of Caldesmon as a Potential Gastric Cancer...

Ngày tải lên: 10/09/2015, 09:09

142 254 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic a...

Ngày tải lên: 16/09/2015, 17:10

182 480 0
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... Objectives of The Study This research is intended to deal with the followings: - To find out the common strategies of encouraging in Vietnamese as...

Ngày tải lên: 26/11/2013, 13:31

13 1,6K 8
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... chance To plan a surprise of it, to aim a book at the public favor, is the most hopeless of all endeavors, as it is one of the unworthie...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... References Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al (2003) Genome sequence of Bacillus cereus and comparative analysis ... of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical dat...

Ngày tải lên: 19/02/2014, 00:20

11 710 0
Tài liệu Test of English as a Foreign Language doc

Tài liệu Test of English as a Foreign Language doc

... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malays...

Ngày tải lên: 20/02/2014, 11:21

36 870 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...

Ngày tải lên: 07/03/2014, 02:20

10 483 0
Từ khóa:
w