Development of a hydrophobicity controlled microfluidic dispenser
Development of a hydrophobicity controlled microfluidic dispenser
... and dynamic micropumps over past 25 years They also indicated that micropumps suitable for important applications such as space exploration and chemical and biological analysis are not available ... 1.7.1 Applications Lab-on -a- chip Two well-known research laboratories, i.e., Digital Microfluidics Lab of Prof Richard Fair at Duke University and Micromanufacturing Lab of Prof Chang-Jin Ki...
Ngày tải lên: 11/09/2015, 16:06
Báo cáo y học: " ALGOS: the development of a randomized controlled trial testing a case management algorithm designed to reduce suicide risk among suicide attempters" potx
... salary from an organization that may in any way gain or lose financially from the publication of this manuscript - They doesn’t hold any stocks or shares in an organization that may in any way ... trial testing a case management algorithm designed to reduce suicide risk among suicide attempters BMC Psychiatry 2011 11:1 Submit your next manuscript to BioMed Cent...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " Study protocol: the development of a randomised controlled trial testing a postcard intervention designed to reduce suicide risk among young help-seekers" ppsx
... chart Study flow-chart: This figure displays the participant flowStudy flow-chart: This figure displays the participant flow-chart written and each postcard individually signed An example of the ... substantial Safety and supervision The research assistant received training in the administration of the measures and in the assessment of suicide risk The research a...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode psychosis treatment centre BMC Psychiatry ... recipients and peer support workers Study design The study is a randomised controlled trial registered with the Australia...
Ngày tải lên: 11/08/2014, 16:22
Development of a method to measure consumer emotions associated with foods
... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...
Ngày tải lên: 03/04/2013, 21:07
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... Risk Management Framework Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...
Ngày tải lên: 15/03/2014, 00:20
Development of a DTPA soil test for zinc, iron, manganese, and cropper
Ngày tải lên: 15/03/2014, 23:56
Development of a simple
... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands i...
Ngày tải lên: 15/03/2014, 23:56
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf
... Semantic Organization of Scientific Terms." Information Storage and Retrieval (April 1967), pp 35-115 Earl, Lois L "Part -of- Speech Implications of Affixes." Mechanical Translation and Computational ... discussion of this specific problem and of this report as a whole DEVELOPMENT OF A STEMMING ALGORITHM After a word in the library user's query has been stemmed and a match...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not...
Ngày tải lên: 23/03/2014, 06:20