Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

... INVESTIGATION OF NEW PROPERTIES AND APPLICATIONS OF QUADRUPLEX DNA AND DEVELOPMENT OF NOVEL OLIGONUCLEOTIDEBASED TOPOISOMERASE I INHIBITORS WANG YIFAN (B.Sc., Soochow University, China) ... 1.3.1 Discovery of i- Motif Form of DNA 11 1.3.2 Stoichiometries and Topologies of i- Motif DNA 11 ii 1.3.3 Possible Biological Role of i- Motif Structure...

Ngày tải lên: 11/09/2015, 16:04

... TGGCGTTAGAGGAAAAGGTTAGGGGTTAGG 3’ 5’ TGGCGTTAGAGGAAAAGGTTAGAGGTTAGG 3’ 5’ TGGGGTTAGGGGAAAAGGTTTGGGGTTAGG 3’ 5’ TGGGGTTAGGGGAAAAGGTTTTGGGGTTAGG 3’ 5’ TGGCGTTAGGGGAAAAAGGTTAGGGGTTAGG 3’ 5’ TGGCGTTAGGGGAAAGGTTAGGGGTTAGG ... TTAGGGTTAGAGTTAGGGTTAAGGT 3’ 5’ TTAGGGTGGGTGGGTGGGT 3’ 5’ TTAGGGTTGGGTTGGGTTGGGT 3’ 5’ TTAGGGTTATGGGTTATGGGTTATGGGT 3’ 5’ TTAGGGTTATTGGGTTATTGGGTTATTGGGT 3’ 5’ GTTAGGGTTAGGGT...

Ngày tải lên: 16/10/2015, 12:00

... Vallinayagam R, Vedharaj S, Yang WM, Raghavan V, Saravanan CG, Lee PS, Chua KJE, Chou SK Investigation of evaporation and engine characteristics of pine oil biofuel fumigated in the inlet manifold ... 131 OPERATION OF PINE OIL IN DUAL FUEL MODE 133 5.1 Investigation of evaporation and engine characteristics of pine oil biofuel fumigated in the inlet...

Ngày tải lên: 12/09/2015, 11:01

... DEVELOPMENT OF NOVEL CHITOSAN- BASED HOLLOW FIBER MEMBRANES FOR APPLICATIONS IN WATER TREATMENT AND BIOENGINEERING HAN WEI (B Eng., Tianjin University) A THESIS SUBMITTED FOR THE DEGREE OF ... of CS -based adsorptive hollow fiber membranes The hollow fiber membranes developed will then be studied for the application of wastewater treatment...

Ngày tải lên: 14/09/2015, 08:49

... in the presence of inhibitor, v0 is the initial velocity in the absence of inhibitor but with (2%) dimethylsulfoxide The IC50 value was determined by tting the percent inhibition versus inhibitor ... substrate binding [17], highlighting their signicance In SpsB, it is also likely that one or more of the amino acids immediately preceding the catalytic serine form a part o...

Ngày tải lên: 07/03/2014, 01:20

... groups (Cbz and NO2) by hydrogenation using Pd ⁄ C (10%) Of the three sets of compounds of 6- and 9-mers of l-, d- and l ⁄ d-enantiomers of arginine chains and their aminoglycoside conjugates ... 1614, 3 6–5 0 Pierson TC & Doms RW (2003) HIV-1 entry and its inhibition Curr Top Microbiol Immunol 281, 1–2 7 Pierson TC, Doms RW & Pohlmann S (2004) Prospects of H...

Ngày tải lên: 16/03/2014, 06:20

... Wageningen, Netherlands; 2004 doi:10.1186/1471-2229-11-147 Cite this article as: Russell et al.: Identification, utilisation and mapping of novel transcriptome-based markers from blackcurrant (Ribes nigrum) ... Five markers were isolated at a lod of The remaining markers formed linkage groups using a lod threshold between and There were two small groups, of t...

Ngày tải lên: 11/08/2014, 11:21

... SYNTHESIS OF NOVEL ACTIVITY BASED PROBES AND COMBINATORIAL PEPTIDE LIBRARIES TO PROFILE PROTEASES RESMI CHANDRASEKHARA PANICKER (M Sc - Mahatma Gandhi University, Kerala, ... mainly focus on the synthesis of positional scanning combinatorial libraries of peptide substrates/inhibitors to profile proteases These works concentrate on the studies of the s...

Ngày tải lên: 12/09/2015, 08:16

... that the Rashba effect in BiTeI is maintained, and a significant spin splitting in graphene s linear band is found, which can be exploited in designing graphene- based spintronic devices to fully ... BiTeI /graphene, Bi2 Se3 /graphene, bilayer graphene, and BN /graphene We discover interesting properties, such as the topological phase transition, Rashba splitting, band gap...

Ngày tải lên: 30/09/2015, 10:12

... Sinha, Devanshu Chakravarty, Rajkumar Patra and Rohit Raja Chapter Density Estimation and Wavelet Thresholding via Bayesian Methods: A Wavelet Probability Band and Related Metrics Approach to Assess ... Chase, Gholamreza Anbarjafari, Hasan Demirel, Sara Izadpenahi, Cagri Ozcinar, Dr Awad Kh Al-Asmari, Farhaan Al-Enizi, Fayez El-Sousy Published by InTech Janeza Trdine 9, 51000 Rije...

Ngày tải lên: 23/03/2014, 03:20

... IC50 (nM) G2019S IC50 (nM) JAK3 inhibitor VI K252A Staurosporine Su-1 124 8 Ro-31- 822 0 22 3.6 2. 0 15 26 71 40 2. 8 1.8 26 1 922 ± ± ± ± ± 2. 5 0 .2 0.1 1.3 895 ± ± ± ± ± 0.1 0.09 1.7 665 with 32P-labeled ... that of G2019S LRRK2, which had an apparent Km of 134 ± lm (P < 0.01; Fig 4C) 35 LRRKtide 32P incorporation Activity of wild-type and G2019S mutant forms of LRRK2 A LR...

Ngày tải lên: 23/03/2014, 06:20

... ID1-2: x 29Si ID1-3: 12 x 13 C Assignments of E15/E16 ligand structure E15 -1: (5-5') 6.43 4.46 x 29Si (4-4') 3.89 4.08 E15-2: x 29Si (1- 1') 0.39 0.34 E15()-3: 5 -11 x 13 C + x 29Si (6-6') 13 . 71 ... Impurity Nc1 Nc2 Bc1 Bc2 Bh 2.0040 2.0037 2.0055 2.0062 2.0020 g 2.0026 2.0030 2.0045 2.0045 2.0068 g 1. 20 1. 19 0.22 0 .19 0 .19 A, mT 1. 20 1. 19 0 .13 0 .12 0 .15 A, mT EC...

Ngày tải lên: 20/06/2014, 04:20