Identification of oct4 and sox2 targets in mouse embryonic stem cells

... Optimisation of the Oct4 and Sox2 ChIP assays 57 3.2.2 Oct4 and Sox2 bind to the distal enhancer of Oct4 in mESCs 58 3.2.3 Oct4 and Sox2 bind to the SRR2 of Sox2 in mESCs 59 3.2.4 Oct4 and Sox2 bind to ... Specificity of Oct4 and Sox2 antibodies used in ChIP 3.2 Oct4 and Sox2 binding to Oct4 CR4 region in mESCs 3.3 Oct4 and Sox2 bi...

Ngày tải lên: 11/09/2015, 16:03

... localized in the nucleus of tumor cells (A) High Oct4 expression in tumor cells, (B) low Oct4 expression in tumor cells, (C) high Sox2 expression in tumor cells, and (D) low Sox2 expression in tumor cells ... and Sox2 expression in hypopharyngeal squamous cell carcinoma Brown grains represent a positive signal (3, 3-diaminobenzidine staining) The po...

Ngày tải lên: 18/06/2014, 16:20

... of data, data analysis and interpretation, manuscript writing and final approval of the manuscript AK was involved in manuscript writing and data analysis SL was involved in the conception and ... of study materials, collection and assembly of data, data analysis and interpretation, manuscript writing and final approval of the manuscript XH Participated in the collection and a...

Ngày tải lên: 10/08/2014, 05:21

... analyze the impact of different chromatin modifiers on the replication timing profile of mouse ES cells We show that, while early replication in ES cells correlates with peaks of increased histone ... staining and cell cycle profiles of the mutant ES cell lines analysed Supplementary Figure contains replication timing profiles of all loci analysed in ea...

Ngày tải lên: 14/08/2014, 08:20

... type of stem cells, embryonic stem cells, from the mouse embryo Embryonic stem cell lines are derived from the inner cell mass (ICM) of the mouse blastocyst at embryonic day 3.5 (E3.5) These cells ... undifferentiated cells and differentiated cells of multiple lineages EC cells could be maintained indefinitely with mitotically inactivated embryonic fibroblast in...

Ngày tải lên: 10/09/2015, 15:51

... that pro and sentences are a mixture of opinions and facts, making identifying them in online reviews a distinct problem from opinion sentence identification Finally, we also apply the resulting ... Determining the Sentiment of Opinions Proceedings of COLING-04 pp 1367-1373 Geneva, Switzerland Kim, Soo-Min and Eduard Hovy 2005 Automatic Detection of Opinion Bearing Words...

Ngày tải lên: 20/02/2014, 12:20

... C5aR and FcgRIII-mediated cell activation resulting in innate cell mediator activation and the production of inflammatory cytokine interleukin-1 and TNF-α, leading to joint destruction In recent ... susceptibility genes By making use of adenovirus-based and cell-based transfers, the feasibility of novel therapeutic interventions will be capable of determination...

Ngày tải lên: 09/08/2014, 01:23

... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT ... ACTGAAAAAAAATGAAGACTA 32 90 - 100 ED019743 BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGA...

Ngày tải lên: 12/08/2014, 03:21

... X-box-regulated /ciliary genes Many, or even the majority, of these candidate ciliary genes when mutated may cause a dye filling defect Since the majority (83 out of 93) of the candidate X-box-regulated genes ... of bona fide Xbox regulated genes in C elegans In fact, there are still seven dyf genes (dyf-4, dyf-7, dyf-8, dyf-9, dyf-10, dyf-11 and dyf12) in C el...

Ngày tải lên: 14/08/2014, 17:22

... Bevans et al.: Function, Adjustment, Quality of Life and Symptoms (FAQS) in Allogeneic Hematopoietic Stem Cell Transplantation (HSCT) Survivors: A Study Protocol Health and Quality of Life Outcomes ... measuring the quality of life in terms of domains: physical symptoms distress, psychological distress, activity level, and overall global life...

Ngày tải lên: 20/06/2014, 15:20

... specification of midbrain dopamine neurons Radial glia cells are neuronal progenitors in vivo 10 11 14 1. 3 Long non- coding RNAs in biology 15 1. 3 .1 1.3.2 1. 3.2 .1 1.3.2.2 1. 3.2.3 Long non- coding RNAs in pluripotency ... pluripotency, and repressing differentiation simultaneously   18   1. 3.2 Long non- coding RNAs in neural developmen...

Ngày tải lên: 09/09/2015, 17:54

Ngày tải lên: 09/09/2015, 17:54

... chr 13: 36 ,31 5,670 -36 ,31 7,9 83 chr4:1,179,572-1,181,6 03 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 AK124684 AK125262 AK12 539 2 AL 832 189 AY927 532 BC008027 BC 030 122 BC 031 955 ... location (NCBI36/hg18) AF242771 AK05 533 5 AK056826 (lncRNA_ES1) AK0911 13 AL117559 AL 833 138 BC02 630 0 (lncRNA_ES3) chr12: 63, 376, 238 - 63, 376,597 chr19: 43,...

Ngày tải lên: 09/09/2015, 17:54

... was confirmed by qPCR in two independent cell lines: hESC (H1)-derived NPCs and an immortalized human neural stem cell line ReN-VM In both hESC-derived cells and ReN-VM cells, RMST expression ... silencing factor, is a transcription factor expressed in neural stem cells and non- neuronal cells, to repress neuronal gene expression To confirm that REST indeed binds up...

Ngày tải lên: 09/09/2015, 17:54

... established in the mouse model system, and very few human lncRNAs have been studied with such extent In this thesis, I focused on examining lncRNAs involved in the pluripotency maintenance of human embryonic ... B., Liu, M., and Shi, T (2011) Comparative analysis of human protein -coding and noncoding RNAs between brain and 10 mixed cell lines by RNA-Seq PLoS...

Ngày tải lên: 09/09/2015, 17:55