Identification of oct4 and sox2 targets in mouse embryonic stem cells
Identification of oct4 and sox2 targets in mouse embryonic stem cells
... Optimisation of the Oct4 and Sox2 ChIP assays 57 3.2.2 Oct4 and Sox2 bind to the distal enhancer of Oct4 in mESCs 58 3.2.3 Oct4 and Sox2 bind to the SRR2 of Sox2 in mESCs 59 3.2.4 Oct4 and Sox2 bind to ... Specificity of Oct4 and Sox2 antibodies used in ChIP 3.2 Oct4 and Sox2 binding to Oct4 CR4 region in mESCs 3.3 Oct4 and Sox2 binding reduces after retinoic acid differentiation of mESCs 3.4 Oct4 and Sox2 ... Characterization of the Sox2 -Oct4 DNA binding motif 119 6.2.4.1 Interactions of Sox2 and Oct4 with the Sox2 -Oct4 joint motifs 6.2.4.1.1 Sox2 and Oct4 bind to the Sox2 -Oct4 DNA motif in vitro 119...
- 270
- 263
- 0
Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc
... localized in the nucleus of tumor cells (A) High Oct4 expression in tumor cells, (B) low Oct4 expression in tumor cells, (C) high Sox2 expression in tumor cells, and (D) low Sox2 expression in tumor cells ... and Sox2 expression in hypopharyngeal squamous cell carcinoma Brown grains represent a positive signal (3, 3-diaminobenzidine staining) The positive expression site of Oct4 and Sox2 was mainly localized ... localized in the nucleus, were observed in the cancer cells of tumor tissues (Fig 1) The distribution of immunostaining Figure Expression of Oct4 and Sox2 Immunohistochemical staining for Oct4 and Sox2...
- 7
- 493
- 0
Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps
... of data, data analysis and interpretation, manuscript writing and final approval of the manuscript AK was involved in manuscript writing and data analysis SL was involved in the conception and ... of study materials, collection and assembly of data, data analysis and interpretation, manuscript writing and final approval of the manuscript XH Participated in the collection and assembly of ... support, administrative support, provision of study materials, collection and assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript as well as serves as...
- 10
- 309
- 0
Báo cáo y học: "The impact of chromatin modifiers on the timing of locus replication in mouse embryonic stem cells" pot
... analyze the impact of different chromatin modifiers on the replication timing profile of mouse ES cells We show that, while early replication in ES cells correlates with peaks of increased histone ... staining and cell cycle profiles of the mutant ES cell lines analysed Supplementary Figure contains replication timing profiles of all loci analysed in each of the mutant ES cell lines analysed ... Collectively, these data suggest that only a minority of loci (5/23; supplementary Figure in Additional data file 2) change their replication timing in response to severe reduction of DNA methylation...
- 13
- 373
- 0
Dissecting transcriptional network in mouse embryonic stem cells
... type of stem cells, embryonic stem cells, from the mouse embryo Embryonic stem cell lines are derived from the inner cell mass (ICM) of the mouse blastocyst at embryonic day 3.5 (E3.5) These cells ... undifferentiated cells and differentiated cells of multiple lineages EC cells could be maintained indefinitely with mitotically inactivated embryonic fibroblast in vitro, and is able to give rise to cells ... These cells were initially maintained in culture as self-renewal and pluripotent cell lines in either EC cell-conditioned medium (Martin, 1981), or in a co-culture system in which cells were grown...
- 257
- 140
- 0
Tài liệu Báo cáo khoa học: "Automatic Identification of Pro and Con Reasons in Online Reviews" ppt
... that pro and sentences are a mixture of opinions and facts, making identifying them in online reviews a distinct problem from opinion sentence identification Finally, we also apply the resulting ... Determining the Sentiment of Opinions Proceedings of COLING-04 pp 1367-1373 Geneva, Switzerland Kim, Soo-Min and Eduard Hovy 2005 Automatic Detection of Opinion Bearing Words and Sentences In the ... 2004 Mining and summarizing customer reviews" Proceedings of the ACM SIGKDD International Conference on Knowledge Discovery & Data Mining (KDD2004), Seattle, Washington, USA Kim, Soo-Min and Eduard...
- 8
- 461
- 1
Báo cáo y học: "4th meeting of the EU research network EUROME: From the identification of genes and cellular networks in murine models of arthritis to novel therapeutic intervention strategies in rheumatoid arthritis, London, UK, 9 March 2004" pot
... C5aR and FcgRIII-mediated cell activation resulting in innate cell mediator activation and the production of inflammatory cytokine interleukin-1 and TNF-α, leading to joint destruction In recent ... susceptibility genes By making use of adenovirus-based and cell-based transfers, the feasibility of novel therapeutic interventions will be capable of determination in future Competing interests ... chronic infection is based on the ability of the bacterium to escape complement-mediated opsonophago- cytosis by binding the complement inhibitor factor H (and in some cases, also the factor H-like...
- 4
- 288
- 0
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT ... ACTGAAAAAAAATGAAGACTA 32 90 - 100 ED019743 BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA ... DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAA FokI -satellite 130 60 81 - 100 DX979624 GGGACTTAGGAGAGTGACCCAACCAAGGAGGGAGACCTCCTTGGGCTGAGT GGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTG...
- 14
- 270
- 0
Báo cáo y học: "Identification of ciliary and ciliopathy genes in Caenorhabditis elegans through comparative genomics" pptx
... X-box-regulated /ciliary genes Many, or even the majority, of these candidate ciliary genes when mutated may cause a dye filling defect Since the majority (83 out of 93) of the candidate X-box-regulated genes ... of bona fide Xbox regulated genes in C elegans In fact, there are still seven dyf genes (dyf-4, dyf-7, dyf-8, dyf-9, dyf-10, dyf-11 and dyf12) in C elegans that remain to be identified However, ... understanding of known BBS genes, the C elegans dye filling defect phenotype, and, most importantly, the presence of a shared synteny of regulatory (X-box) motifs among conserved genes It will be of...
- 12
- 326
- 0
báo cáo hóa học: " Function, Adjustment, Quality of Life and Symptoms (FAQS) in Allogeneic Hematopoietic Stem Cell " potx
... Bevans et al.: Function, Adjustment, Quality of Life and Symptoms (FAQS) in Allogeneic Hematopoietic Stem Cell Transplantation (HSCT) Survivors: A Study Protocol Health and Quality of Life Outcomes ... measuring the quality of life in terms of domains: physical symptoms distress, psychological distress, activity level, and overall global life quality in various types of cancer patients undergoing ... clinical outcomes in this patient population This paper presents the rationale for and design of a longitudinal study to examine Page of functional status, adjustment, quality of life, and symptoms...
- 9
- 488
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1
... specification of midbrain dopamine neurons Radial glia cells are neuronal progenitors in vivo 10 11 14 1. 3 Long non- coding RNAs in biology 15 1. 3 .1 1.3.2 1. 3.2 .1 1.3.2.2 1. 3.2.3 Long non- coding RNAs in pluripotency ... pluripotency, and repressing differentiation simultaneously 18 1. 3.2 Long non- coding RNAs in neural development Long non- coding RNAs are abundant in the brain, and a study scrutinizing in situ hybridization ... Long non- coding RNAs in neural development Nkx2.2AS Evf2 Malat1 16 19 19 20 20 1. 4 Molecular mechanisms of long non- coding RNA function 21 1.4 .1 LncRNAs behave as scaffolds that target protein...
- 83
- 381
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3
... chr 13: 36 ,31 5,670 -36 ,31 7,9 83 chr4:1,179,572-1,181,6 03 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 AK124684 AK125262 AK12 539 2 AL 832 189 AY927 532 BC008027 BC 030 122 BC 031 955 ... location (NCBI36/hg18) AF242771 AK05 533 5 AK056826 (lncRNA_ES1) AK0911 13 AL117559 AL 833 138 BC02 630 0 (lncRNA_ES3) chr12: 63, 376, 238 - 63, 376,597 chr19: 43, 012, 031 - 43, 014, 637 chr3:171,595,099-171,597 ,31 2 chr5:67,124,797-67, 132 ,641 ... AK12 539 2 AL 832 189 BC008027 BC 030 122 BC 031 955 BC 033 371 BC 035 156 BC 036 480 BC 038 536 BC041400 BC041859 BC042044 BC0 432 37 BC0 432 54 BC0 433 80 BX649145 L31955 chr8:110,725,520-110,729,489 chr 13: 36 ,31 5,670 -36 ,31 7,983...
- 55
- 327
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4
... was confirmed by qPCR in two independent cell lines: hESC (H1)-derived NPCs and an immortalized human neural stem cell line ReN-VM In both hESC-derived cells and ReN-VM cells, RMST expression ... silencing factor, is a transcription factor expressed in neural stem cells and non- neuronal cells, to repress neuronal gene expression To confirm that REST indeed binds upstream of RMST in the neural ... chromatin binding Quantitative PCR of the ChIP DNA revealed REST occupancy at the region upstream of RMST (pRMST), confirming that REST binds upstream of RMST in the human neural stem cell line (Figure...
- 13
- 275
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
... established in the mouse model system, and very few human lncRNAs have been studied with such extent In this thesis, I focused on examining lncRNAs involved in the pluripotency maintenance of human embryonic ... B., Liu, M., and Shi, T (2011) Comparative analysis of human protein -coding and noncoding RNAs between brain and 10 mixed cell lines by RNA-Seq PLoS One 6, e28318 Chen, M., Zhang, J., and Manley, ... Amable, R., and Freed, W.J (2008) Assessment of stromal-derived inducing activity in the generation of dopaminergic neurons from human embryonic stem cells Stem Cells 26, 151 7- 152 5 Walker, E.,...
- 34
- 316
- 0
Từ khóa: dna damage response and mutagenesis in mouse embryonic stem cells pdfuse of chemical mutagenesis in mouse embryonic stem cells pdfgene silencing in mouse embryonic stem cellsintegrins and vascular development in differentiated embryonic stem cells in vitro pdfchromatin immunoprecipitation based analysis of gene regulatory networks operative in human embryonic stem cellsautomatic identification of pro and con reasons in online reviewsidentification of gene and protein targets to drugs and vaccine developmentdifferentiation of mouse embryonic stem cells into endothelial cells genetic selection and potential use in vivo pdfoct4 klf4 and sox2 in human embryonic stem cellsformation of gut like structures in vitro from mouse embryonic stem cells pdfsensing bmp pathway activity by immune detection of phosphorylated r smad proteins in mouse embryonic kidneyfunctional analysis of human brca2 variants using a mouse embryonic stem cell based assayexcitation contraction coupling functional properties and autonomic and hormonal regulation in human embryonic stem cell derived cardiomyocytescripto signaling in differentiating embryonic stem cells pdfuse of simian immunodeficiency virus vectors for simian embryonic stem cells pdfNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP