Regulation of WNT beta catenin pathway in the disease progression of osteosarcoma
... points in the Wnt/ β -catenin pathway with the aim of developing novel Wnt- targeted therapies to prevent or reduce osteosarcoma disease progression 1.4 Strategies in inhibiting the Wnt/ β -catenin ... while the tyrosine kinases Fer, Fyn or Met are capable of inducing phosphorylation of tyrosine residue 142 of β -catenin to disrupt interaction with α -catenin...
Ngày tải lên: 11/09/2015, 10:18
... B, Michel H & Mantele W ¨ 411 Proton access to Paracoccus cytochrome c oxidase 23 24 25 26 27 28 29 30 (1998) Involvement of glutamic acid 278 in the redox reaction of the cytochrome c oxidase ... denitrificans aa3 cytochrome c oxidase FEBS Journal 272 (2005) 404–412 ª 2004 FEBS Proton access to Paracoccus cytochrome c oxidase E78II does not repr...
Ngày tải lên: 30/03/2014, 15:20
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients an...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: "Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis" doc
... as: Huang et al.: Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis Allergy, Asthma & Clinical ... AP, TN, and SS aided in the immunohistochemistry VS, CN, AQ, DB, WB, KC, JK, JP, and LN and KN aiding in obtaining biopsy and blood samples NR a...
Ngày tải lên: 08/08/2014, 21:20
báo cáo khoa học: "Compound Kushen Injection suppresses human breast cancer stem-like cells by down-regulating the canonical Wnt/b-catenin pathway" potx
... et al.: Compound Kushen Injection suppresses human breast cancer stem-like cells by down-regulating the canonical Wnt/b-catenin pathway Journal of Experimental & Clinical Cancer Research 2011 30:103 ... to injection of SP cells (1 × 104 cells, × 103 cells) compared with non-SP injection (1 × 104 cells, × 103 cells) (C) A representative tumor in a mouse sp...
Ngày tải lên: 10/08/2014, 10:21
Anti inflammatory effects of inhibitors of the NF kb pathway in the mouse asthma model
... 1.2.1 Introduction of the NF- κB pathway 30 1.2.2 Role of the NF- κB pathway in allergic inflammation 39 1.3 Inhibitors of NF- κB signaling cascades 40 1.3.1 The GSK-3β inhibitor 41 1.3.1.1 The GSK-3 ... andrographolide may exert its antiinflammatory effects by inhibiting the phosphorylation of IKKβ and suppressing the DNA-binding activity of p65 Taken toget...
Ngày tải lên: 11/09/2015, 16:03
Báo cáo y học: "Molecular defects in the mannose binding lectin pathway in dermatological disease: Case report and literature review" pps
... et al.: Molecular defects in the mannose binding lectin pathway in dermatological disease: Case report and literature review Clinical and Molecular Allergy 2010 8:6 Submit your next manuscript ... Enhancement of complement activation and opsonophagocytosis by complexes of mannose- binding lectin with mannose- binding lectin- associated serine protease...
Ngày tải lên: 13/08/2014, 13:22
Investigating the superoxide mediated survival pathway in the prostate cancer cell line LNCaP
... result in cell death The delicate redox balance is kept in check, and is often the deciding factor in determining cell fate in these cancer cells 1.6 PROSTATE CANCER Prostate cancer, the cancerous ... classified under the extrinsic and intrinsic pathway The extrinsic pathway involves the direct transduction of an external signal that activates apoptosis T...
Ngày tải lên: 09/09/2015, 17:52
Báo cáo y học: "Regulation of the JNK pathway by TGF-beta activated kinase 1 in rheumatoid arthritis synoviocytes" pps
... GS: Regulation of c-Jun N-terminal kinase by MEKK-2 and mitogen -activated protein kinase kinase kinases in rheumatoid arthritis J Immunol 2004, 17 2 :16 12 -16 18 Huang Q, Yang J, Lin Y, Walker C, Cheng ... purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 Vol No Hammaker et al Mor A, Abramson SB, Pillinger MH: The fibroblast-like syno...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc
... as: Brodsky et al.: The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages ... kinetics I At h, AS101 probably enters the nucleus and may interfere with the DNA-binding ability of the NFB complex resulting in...
Ngày tải lên: 11/08/2014, 08:22
báo cáo khoa học: " An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae" pptx
... repeats in the DNA-binding domain including R3 MYB (MYB1 R) with one repeat, R2R3 MYB with two repeats, and R 1R2R3 MYB (MYB3 R) with three repeats [15,16] Among these MYB transcription factors, R2R3- MYBs ... dicots and monocots To ascertain if there is an identifiable protein motif specific for anthocyanin- promoting MYBs in the N-terminal R2R3 domain, the...
Ngày tải lên: 12/08/2014, 03:21
Regulation of navigation and vessel-source pollution in the Northern Sea Route - Article 234 and state practice
... (NSRA), including the Guide to Navigating through the Northern Sea Route (NSR Navigation Guide) and the Requirements for the Design, Equipment and Supplies of Vessels Navigating the Northern Sea Route ... adjoining the USSR northern coast and that it includes seaways suitable for guiding vessels in ice Due to the vagueness concerning leading in Artic...
Ngày tải lên: 01/11/2013, 09:20
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... confirmed by Lin-54 binding to the CHR, cooperating with E2F4 binding to the CDE in EMSAs in vitro [86] ChIP experiments on the Cdc2 gene also provided insights into the association of other cell cycle ... proteins with the promoter E2F4 binding during the cell cycle coincides with the binding of p107 or p130 [61,85] Another E2F site distal to the E2F ⁄ CDE acts...
Ngày tải lên: 16/02/2014, 09:20