Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

... SEROTONIN AND SEROTONIN RECEPTORS IN NEURAL STEM AND PROGENITOR CELL PROLIFERATION TAN CHEE KUAN FRANCIS (B.Sc.(Hons.), M.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN ... showing NSPC specific viii expression Reduction in NSPC proliferation in TPH1 KO mice further pointed to the role of TPH1 in regulating and maintaining NSPC prolif...

Ngày tải lên: 11/09/2015, 10:15

... alpha nasal epithelial stem or progenitor cells inner dynein arms immunofluorescence intraflagellar transport also Tg737, intraflagellar transport 88 intraflagellar transport protein A intraflagellar ... microorganism stimulation and inflammatory cells disorder, epithelial damage and remodeling occurred in NPs Epithelial repair and damage As the results of genetic pred...

Ngày tải lên: 09/09/2015, 11:29

... statistically significant Results CK2a is overexpressed in colorectal cancer CK2a protein expression was analyzed in 144 patients (104 with CRC and 40 with colorectal adenoma) Staining for CK2a ... Figure CK2a protein expression in CRC tissues and cell lines (A) Western blot analysis of CK2a expression in eight pairs of CRC tissues and adjacent, normal col...

Ngày tải lên: 18/06/2014, 19:20

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên: 20/06/2014, 04:20

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên: 20/06/2014, 07:20

... that the inhibitory effect of NAMI-A on c-myc gene expression may have occurred by suppressing ERK1/2 activation and activity elicited by PMA-generated signals Unlike the ras gene family, mutations ... relationship between the inhibitory effect of NAMI-A on ERK1/2 activation and NAMI-A- induced down regulation of c-myc gene expression NAMI-A inhibits...

Ngày tải lên: 21/02/2014, 01:21

... impact on their chemo- and radiosensitizing properties It remains unclear if the decline in cyclin D1 levels results from ATR inhibition, the inhibition of both ATM and ATR, or from the inhibition ... require further characterization ATR unlike ATM regulates cell cycle progression in the absence of DNA damage and is required for the viability of proliferating...

Ngày tải lên: 09/08/2014, 10:20

... attention has been given to the role of angiogenesis in cancer One of the earliest references to angiogenesis and cancer was made by Ide and Figure 1.3B Diseases Resulting from Abnormal Levels of Angiogenesis ... engaged in the development of dual inhibitors of angiogenesis and cancer cell proliferation This effort originated with the goal of modifying...

Ngày tải lên: 13/11/2014, 11:20

... problems Hyaluronic acid (HA) and collagen are ubiquitous and are major components of extracellular matrix (ECM) in the mammalian body HA has a high capacity for holding water and possesses a high ... phenobarbital and euthanized Blocks of facial muscles were fixed for three days in 4% paraformaldehyde and embedded in paraffin Sections were de-waxed and sta...

Ngày tải lên: 18/06/2014, 15:20

... of publications • Tham M, Ramasamy S, Gan H, Ramachandran A, Poonepalli A, Yu YH, Ahmed S Chondroitin sulfate proteoglycan stimulates neural stem cell survival via EGFR signalling pathways Manuscript ... quiescent and only become activated at the start of each hair cycle In addition, they are activated during tissue damage and participate in wound healing (Blanpain...

Ngày tải lên: 12/09/2015, 21:26

... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in...

Ngày tải lên: 30/09/2015, 06:36

... source of cells and the potential to derive the cell type of interest together with the possibility to enrich for genetic modifications during the dividing stem cell state 1.1.1 Human pluripotent stem ... stem cells Landmark discoveries of the young field of human stem cell science were the isolation and culture of inner cell mass from hu...

Ngày tải lên: 26/11/2015, 09:54

... only the longest amino acid sequences that included the DNA binding, hinge and ligand-binding domains were used for this analysis, except for the Knirps family members that lack the LBD In D ... processes In A aegypti, the discrete expression of both AaHR3 and AaHR4 suggests their function in the regulatory hierarchy in the mosquito fat body during vitellogenesi...

Ngày tải lên: 18/02/2014, 13:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20