Normal projective surfaces and dynamics of automorphism groups of projective varieties

... proof of Theorem 1.5 AMPLENESS OF −KX ¯ 1.5 17 Ampleness of −KX ¯ In the proof of Theorem 1, for each weighted graph of C + D in Figure 1.6, we ¯ constructed a normal projective surface X of ... listed in the second column of Figure 1.1, and 2) the possible sizes of D are given in the third column of Figure 1.1 We will leave the proof of (2) in Section 1.4 Proof of...

Ngày tải lên: 11/09/2015, 10:14

Ngày tải lên: 13/11/2014, 11:19

... change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew Kachites McCallum 2002 Mallet: A machine learning for language ... mixed-lingual data with an application to parsing Ph.D thesis, Institute for Communicating and Collaborative Systems, School of Informatics, University of Edinburgh Eduardo G Altma...

Ngày tải lên: 19/02/2014, 19:20

... structure / w 16 1 ± )4 8 ± )2 0 16 0 )4 8 14 )4 0 ± 11 )9 0 ± 21 )6 4 )4 3 )6 0 13 12 8 ± 12 )6 3 ± 30 )7 0 13 0 )6 0 17 48 ± 68 )1 2 8 ± 93 )1 2 0 45 18 0 51 )4 ± 13 90 58 )2 2 ± 46 )6 2 ± 10 5 )6 3 )4 0 )6 0 10 4 )1 3 5 ... )1 3 5 ± 73 )8 7 )1 7 0 44 )2 3 ± 16 )6 3 )3 5 23 13 5 ± )1 1 0 ± 17 )7 5 1...

Ngày tải lên: 07/03/2014, 05:20

... Overlay of HSQC spectra collected at 300 K of single CCP1 and CCP2 and of pair of modules at neutral and acidic pH Doc S1 Intermodule cooperativity in the structure and dynamics of consecutive complement ... (CCP1single) and second complement control protein module of C1r (CCP2single) for the single CCP modules, and CCP1CCP2 and CCP1CCP2 fo...

Ngày tải lên: 15/03/2014, 23:20

... standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth of the EPR spectra packs ... these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stabili...

Ngày tải lên: 16/03/2014, 01:20

... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTT...

Ngày tải lên: 29/03/2014, 23:20

... show the degree of correlation with the phylogeny of S pneumoniae, the data are reported on the phylogenetic tree of the S pneumoniae strains Only the topology of the tree is shown, branch lengths ... similarity and gene organization [47] To verify whether the allelic profile of antigens correlates with pneumococcal phylogeny, we have mapped the allelic varian...

Ngày tải lên: 09/08/2014, 22:23

Ngày tải lên: 14/11/2014, 10:21

Ngày tải lên: 14/11/2014, 13:35

... barriers into account, to predict the diffusion coefficient as a function of temperature and hydrogen coverage Our findings provide insights into the understanding of the diffusive and frictional phenomena ... regimes of surface diffusion in C60/ graphene system according to the effect of temperature and rotational degrees of freedom (DOFs) of the admolecule In...

Ngày tải lên: 08/09/2015, 17:49

... analytes, containing 1, and 10 nM of icariin, icaritin and desmethylicaritin; 5, 30 and 60 nM of icariside I and 71 icariside II, respectively and internal standard in pooled rat sera, were placed ... using lipofectamine Sixteen hours posttransfection, the cells were washed, trypsinized and split at ratio of in 10, in 100 and in 1000 into selective cell cultur...

Ngày tải lên: 10/09/2015, 15:48

... bioactivity of androgenic compounds in sera (Fig 26 F) 120 Figure 26 : Estrogenicity in serum following ingestion of estradiol valerate or Epimedium decoction Following baseline blood sampling (—▲—), ... (1.00-1. 12) 0.043 E2V 21 16 1.67 (1.58-1.77)

Ngày tải lên: 10/09/2015, 15:54

... that of genistein and kaempferol (Maggiolini et al., 20 04; Leung et al., 20 04) The presence of serum reduced ERα binding of quercetin in MCF-7 cells, with relative binding affinities for genistein, ... effectiveness in sera of the decoction when administered orally Ingestion of a defined Epimedium decoction resulted in a 6% increase in ERα AUC effect over baseline...

Ngày tải lên: 10/09/2015, 15:54

... ascertain whether the ingestion of estrogenic prenylflavonoids from Epimedium for the purpose of maintaining bone health can increase risk of ERα-positive breast cancer Interestingly, icaritin, ... and sulfatase Non-linear pharmacokinetics and prolonged effects for up to 72 h following administration of a single dose of Epimedium extract were also observed Coupled pr...

Ngày tải lên: 10/09/2015, 15:54