Identification and characterization of svp interacting proteins of short vegetative phase in arabidopsis thaliana
... function of most of the J-domain proteins remains to be elucidated The function of several known J-domain proteins will be discussed in detail in section 1.5 29 1.5 Function of J-domain proteins during ... J-domain proteins in the Arabidopsis genome (Rajan and D'Silva, 2009) These J-domain proteins are classified into four distinct groups Type I J-domain proteins...
Ngày tải lên: 11/09/2015, 10:02
... flowering mainly under short days, converges with the photoperiod pathway at the level of LFY transcription control (Parcy, 2005) 1.6 SHORT VEGETATIVE PHASE (SVP) SHORT VEGETATIVE PHASE (SVP), which encodes ... that other target genes of SVP exist, besides FT and SOC1, in control of flowering Therefore, in this study, we investigated target genes of SVP...
Ngày tải lên: 22/10/2015, 21:20
... flowering phenotype of the soc1 mutant and the mutation of AGL24 suppresses the early flowering of overexpression of SOC1, indicating that AGL24 is one of the downstream target genes of SOC1 (Yu et ... repressors of the GA pathway in the control of flowering time These genes also participate in feedback-control of GA biosynthesis SPY is another repressor of the GA pathway,...
Ngày tải lên: 11/09/2015, 09:57
the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae
Ngày tải lên: 14/11/2014, 06:20
Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides
... Bibliography 195 Appendix 224 Publications 238 vi Summary Identification and characterization of novel proteins from a rare Australian elapid snake Drysdalia coronoides Partial transcriptome from ... venomous terrestrial snakes of the Elapidae family have undergone an extensive radiation in Australia [12] Elapid snake genus Drysdalia from southern Austr...
Ngày tải lên: 11/09/2015, 10:02
Identification and characterization of proteins that interact with zonula occludens proteins
... IDENTIFICATION AND CHARACTERIZATION OF PROTEINS THAT INTERACT WITH ZONULA OCCLUDENS PROTEINS P JAYA KAUSALYA (B.Sc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... in TJ that are part of MAGUK family Fig 13: Structure of PDZ3 domain of PSD-95 with a peptide ligand Fig 14: Possible modes of interaction of PDZ containing protei...
Ngày tải lên: 16/09/2015, 08:31
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic a...
Ngày tải lên: 16/09/2015, 17:10
Identification and characterization of interacting protein of CD157
... Introduction 1 Molecular characterization of CD157 1.1 Identification of CD157 1.2 Cellular expression and tissue distribution of CD157 1.3 Genomic structure of CD157 Biological function of CD157 2.1 Pathophysiological ... Pathophysiological roles of CD157 2.2 Cellular functions of CD157 2.3 Enzymatic activities of CD157 2.4 Signaling property of CD157...
Ngày tải lên: 22/10/2015, 21:20
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf
... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx
... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps
... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...
Ngày tải lên: 06/08/2014, 18:20
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS partic...
Ngày tải lên: 09/08/2014, 08:22