Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamH...

Ngày tải lên: 30/03/2014, 20:20

9 380 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/liz...

Ngày tải lên: 07/08/2014, 18:21

6 347 0
Development of a windows based computer aided die design system for die casting

Development of a windows based computer aided die design system for die casting

... Du Xiaojun, Cao Jian, Saravanakumar Mohanraj, Atiqur Rahman and Low Leng Hwa Maria Financial assistance in the form of research scholarship from the National University of Singapore is also sincerely ... prototype die casting die design system on a commercial solidsbased CAD platform Since die casting die design has been increasingly carried out on solids -based CAD...

Ngày tải lên: 04/10/2015, 15:52

121 649 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed a...

Ngày tải lên: 31/03/2014, 08:20

7 345 0
development of a biosensor based on laser fabricated

development of a biosensor based on laser fabricated

... the DNA concentration of 0.5 ␮M According to the calibration, the increased deflection indicates that the cantilever bends downward, away from the DNA-coated side (the probe DNA is coated on the ... Hagan, A K Chakraborty, and A Majumdar, Proc Natl Acad Sci U.S .A 98, 1560 (2001) G Wu, R H Datar, K M Hansen, T Thundat, R J Cote, and A Majumdar, Nat Biotechnol 19, 856 (2001) C A Sa...

Ngày tải lên: 06/05/2014, 08:55

3 351 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design...

Ngày tải lên: 20/06/2014, 04:20

9 457 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21

9 359 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the sy...

Ngày tải lên: 11/08/2014, 05:21

6 440 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and...

Ngày tải lên: 11/08/2014, 16:20

6 351 0
w