Development of a bioresorbable bone graft alternative for bone engineering applications

Development of a bioresorbable bone graft alternative for bone engineering applications

Development of a bioresorbable bone graft alternative for bone engineering applications

... S, Bai HF, Gajadar B, Mia W, Amber S, Monica S, iv Sambit S, Amit K, Radek and Joanna, Sang Joon A, Tarik A, Anand L, staff of Bioengineering, Orthopaedic Surgery, DES SGH and NUSTEP For all ... sectioned and sawed through the implantation site for gross examination and biocage material retrieval Image shows all sample groups at months (A) Autograft: uniform bone trabeculae observed...

Ngày tải lên: 11/09/2015, 09:58

252 322 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...

Ngày tải lên: 18/06/2014, 22:20

12 510 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATG...

Ngày tải lên: 20/06/2014, 04:20

12 471 0
báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot

báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot

... dyspnoea or sleepiness [2] The lack of research relating to fatigue in this population may be due in part to lack of tools available to accurately measure the experience of fatigue in MND There are ... Summary Analysis figures for Rasch analyses of the NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial...

Ngày tải lên: 20/06/2014, 15:20

31 318 0
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

... phase of measurement, with the aim of developing a valid and reliable patient reported outcome scale for fatigue, the Neurological Fatigue Index (NFIMS) The items in the scale are based on the ... the notion that the sub-dimensions were part of a single, supraordinate theme of neurological fatigue Fit of scale data to the Rasch model also...

Ngày tải lên: 12/08/2014, 01:21

10 356 0
Development of a new elastic path controller for the collaborative wheelchair assistant

Development of a new elastic path controller for the collaborative wheelchair assistant

... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Ass...

Ngày tải lên: 11/09/2015, 09:59

160 310 0
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak depe...

Ngày tải lên: 14/09/2015, 10:36

162 393 0
Development of a generic three dimensional model for stratified flows

Development of a generic three dimensional model for stratified flows

... flows Although two -dimensional models are Chapter computationally efficient and their results are generally reasonable, most practical applications generally require a full three- dimensional analysis ... Reynolds Averaged Navier-Stokes Equations The time averaged form of the Navier-Stokes equations are called the Reynolds Averaged 12 Chapter Navier-Stokes (RANS) equations These mo...

Ngày tải lên: 04/10/2015, 15:46

57 207 0
Identifcation and stablization of a novel 3d hepatocyte monolayer for hepatocyte based applications

Identifcation and stablization of a novel 3d hepatocyte monolayer for hepatocyte based applications

... 2.3.1 Fabrication and characterization of PET film grafted with poly-acrylic acid 49 2.3.2 Fabrication and characterization of bioactive substrata 51 2.3.3 Enhancement of hepatocyte attachment ... LIST OF SYMBOLS 3-MC 3-methylcholanthrene AHG 1-O-(6’-aminohexyl)-D-galactopyranoside AMC Academic Medical Center ALF Acute liver failure ALT Alanine Transaminase APAP Acetaminophen AS...

Ngày tải lên: 12/09/2015, 08:19

167 253 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not...

Ngày tải lên: 23/03/2014, 06:20

11 449 1
w