Defect engineering in the formation of ultra shallow junctions for advanced nano metal oxide semiconductor technology
... DEFECT ENGINEERING IN THE FORMATION OF ULTRA- SHALLOW JUNCTIONS FOR ADVANCED NANO- METAL- OXIDESEMICONDUCTOR TECHNOLOGY YEONG SAI HOOI (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF ... USJs for the application in nano- CMOS devices through the understanding and maneuvering of dopant -defect interactions, known as defect engineering T...
Ngày tải lên: 11/09/2015, 09:58
... process windows Laser annealing offers several advantages over conventional processing techniques: 1) the junction depth is defined by the amorphous/crystalline interface Laser annealing, combined ... and ultra- shallow junctions The degree of melting is determined by the extent of laser absorption and rate of heat dissipation, which are dependent on the substrate prop...
Ngày tải lên: 06/10/2015, 21:15
... FABRICATION OF ULTRA- SHALLOW JUNCTIONS AND ADVANCED GATE STACKS FOR ULSI TECHNOLOGIES USING LASER THERMAL PROCESSING CHONG YUNG FU (B A Sc (First Class Hons.), NTU) A THESIS SUBMITTED FOR ... fabricate ultra- shallow p+/n junctions and advanced poly-Si gate stacks for ultra- large scale integration technologies LTP of ultra- shallow ju...
Ngày tải lên: 12/09/2015, 11:29
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... enzymatic assays using human and porcine P450c17 in the presence of various substrates – preg, 17aOHpreg and DHEA – and analyzed androstadienol formation from each substrate As observed in Fig ... its activity increasing to 15% of preg transformation while the activity of human P450c17 increases to 12% These results show that human and porcine P450c17 hav...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc
... al., In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of ?-amyloid plaques associated with Alzheimer's disease Theoretical ... whereas the activity of AChE declines BChE may, therefore, play a more prominent role in ACh hydrolysis in the aging brain The presenc...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: " HIV-1 Accessory Protein Vpr: Relevance in the pathogenesis of HIV and potential for therapeutic interventio" ppsx
... previously, Vpr plays a significant role in the permissive infection of HIV- 1 into macrophages and may increase the survival of infected myeloid cells; therefore, it is indirectly related to HIV- D pathogenesis ... impairment in HIV- 1 patients as well as a necessary factor for the infection and survival of HIV infected macrophages, thereby further contributi...
Ngày tải lên: 13/08/2014, 01:20
Effects of misspecification in the approach of generalized estimating equations for analysis of clustered data
... clustered data They proposed an extension of generalized linear model to the analysis of longitudinal data It’s proven that the generalized estimating equations can give consistent estimates of the regression ... GENERALIZED ESTIMATING EQUATIONS 16 Generalized Estimating Equations (GEE), the prime subject in my thesis, are traditionally presented as...
Ngày tải lên: 05/10/2015, 13:53
Issues and challenges in the application of micro ball bearing for silicon based microsystems
... ISSUES AND CHALLENGES IN THE APPLICATION OF MICRO- BALL BEARING FOR SILICON BASED MICROSYSTEMS ROBIN PANG SUI TING (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... of the micro- ball) and the operating conditions (RPM of the Si plate) for the groove-less ball bearings setup Thus, a micro- ball can rem...
Ngày tải lên: 08/11/2015, 17:16
báo cáo khoa học: "Magnitude of risks and benefits of the addition of bevacizumab to chemotherapy for advanced breast cancer patients: Meta-regression analysis of randomized trials" ppt
... Magnitude of risks and benefits of the addition of bevacizumab to chemotherapy for advanced breast cancer patients: Meta-regression analysis of randomized trials Journal of Experimental & Clinical Cancer ... bevacizumab to chemotherapy for advanced breast cancer strengthen the need of a deep analysis of the correlation betwee...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Ultra-low microcurrent in the management of diabetes mellitus, hypertension and chronic wounds: Report of twelve cases and discussion of mechanism of action"
... and diseases such as type diabetes mellitus, obesity and the metabolic syndrome (30) In these conditions there is an elevation of both glucose and free fatty acid levels in the blood and an increase ... discontinuation of therapy HbA1c increased to 7.8 Discussion The results of this preliminary trial showed that ultra-low microcurrent has apparent therapeutic e...
Ngày tải lên: 26/10/2012, 09:39
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural re...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf
... deviation of three to four measurements In addition to measuring the formation of aspartyl phosphate, the catalytic cycle of a P-type ATPase can be characterized by determining the decay rate of the ... changes in Mg2+ ligation so that in the E1 state Mg2+ is ligated by residues in the hinge motif in the P domain and by residues in the N domain, w...
Ngày tải lên: 17/03/2014, 17:20
The formation of the plural noun in English and Vietnamese equivalents
... compare the differences between the formation of plural nouns in English and in Vietnamese 36 Chapter two :The formation of plural nouns in English and Vietnamese equivalents In English, the English ... reference books and on the internet to select the valuable information relating to the theme the forming of the plural nouns in E...
Ngày tải lên: 19/03/2014, 17:10