Biomechanical microdevices to study circulating cancer cells in hematogenous metastasis
... it simple to be integrated to existing laboratory microscopes and immunofluorescence staining can be done in situ to distinguish cancer cells from hematopoietic cells This also minimizes the use ... tumor cells in a spiked sample using the microdevice Immuno-fluorescence staining to detect cancer cells using DAPI(blue) to counterstain the cell nucleus, CD45(green) fo...
Ngày tải lên: 11/09/2015, 09:17
... value of the molecular detection of circulating tumor cells using a multimarker reverse transcription-PCR assay for cytokeratin 19, mammaglobin A, and HER2 in early breast cancer Clin Cancer ... Value of the Molecular Detection of Circulating Tumor Cells Using a Multimarker Reverse Transcription-PCR Assay for Cytokeratin 19, Mammaglobin A, and HER2 in Early...
Ngày tải lên: 10/08/2014, 22:20
... 1.1 Introduction The Board of Directors of the Reserve Bank of India, at its meeting held on October 15, 2010 formed a Sub-Committee of the Board to study issues and concerns in the microfinance ... assets of the banking system, it is increasing rapidly 3.7 Finally, given the need to encourage the growth of the Microfinance sector and...
Ngày tải lên: 15/03/2014, 14:20
Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt
... was treated with VD3, and apoptosis was evaluated (D) *P < 0.05, **P < 0.01, (n = 3) participated in the VD3-induced apoptosis in gastric cancer cells indicated that vitamin D induced PTEN expression ... deacetylase (HDAC) inhibitors trichostatin A (TSA) and sodium butyrate (NaBu), and the methylation inhibitor 5-aza-2¢-deoxycytidine (5-Aza) Fig S2 Vitamin D...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: "Comparative study of endocrine cells in the principal pancreatic islets of two teleosts, Silurus asotus (Siluridae) and Siniperca scherzeri (Centropomidae)" potx
... 1987) In the present study, the regional distribution and relative frequency of endocrine cells in the principal pancreatic islets of two species teleosts, Silurus asotus Linne (Siluridae) and Siniperca ... antisera against mammalian insulin, glucagon, somatostatin and PP, in the pancreas of teleosts, localization of endocrine cells...
Ngày tải lên: 07/08/2014, 14:23
Báo cáo khoa học: "Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro" ppsx
... lines In addition, propranolol showed a synergism of growth inhibition in combination with irradiation in SGC-7901 and BGC-823 cells On the contrary, isoproterenol demonstrates anti-irradiation ... Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro Radiation Oncology 2010 5:98 Subm...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Reduced number and impaired function of circulating progenitor cells in patients with systemic lupus erythematosus" pot
... remained the same in healthy control cells Representative bands from the western blot are shown The decrease in the number of circulating progenitor cells in patients with SLE is similarly seen in ... antibody pair and recombinant protein as standard from R&D Systems (Oxon, UK) After incubation and binding of biotinylated antibodies, the color reaction was perfor...
Ngày tải lên: 09/08/2014, 10:20
báo cáo khoa học: "Inhibition of angiogenesis- and inflammation-inducing factors in human colon cancer cells in vitro and in ovo by free and nanoparticle-encapsulated redox dye, DCPIP" pptx
... Mondalek et al., Inhibition of angiogenesis- and inflammation-inducing factors in human colon cancer cells in vitro and in ovo by free and nanoparticle-encapsulated redox dye, DCPIP Journal of Nanobiotechnology ... Detection of angiogenesis- and inflammation-inducing factors by Western blot analysis HCT116 cells were treated with empty...
Ngày tải lên: 11/08/2014, 00:22
Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx
... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors Genes Dev 20, 1496–1510 ... Suppression of epidermal growth factor receptor, mitogen-activated protein kinase, and Pak1 pathways and invasiveness of human cutaneous squamous cancer cells by the...
Ngày tải lên: 16/02/2014, 09:20
Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx
... D, Watterson A, Reinhartz A, Gilberston M: Occupational histories of cancer patients in a Canadian cancer treatment centre and the generated hypothesis regarding breast cancer and farming Int ... Hormonal Factors in Breast Cancer: Breast cancer and breastfeeding: collaborative reanalysis of individual data from 47 epidemiological studies in 30 countries, inclu...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells potx
... results obtained indicated that mature miR-143 enhanced sensitivity to 5-FU Indeed, cell viability was reduced and cell death was increased in HCT116- OV3 compared to parental and HCT116- EM1 cells, ... growth and ⁄ or escape from apoptosis In addition, miR-143 expression has been shown to increase after a-mangostin exposure in human colon cancer DLD-1 cells, res...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR indu...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Modulation of IMPDH2, survivin, topoisomerase I and vimentin increases sensitivity to methotrexate in HT29 human colon cancer cells docx
... Functional validation of IMPDH2 HT29- R cells were incubated with increasing concentrations of chemical inhibitors of IMPDH activity, benzamide riboside, tiazofurin or mycophenolic acid, in the ... Survivin is a member of the inhibitor of apoptosis protein (IAP) family [28] which directly inhibits caspase-3, -7 [29–31], and caspase-9 activities [32,33] Moreover, survivin indi...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: BRCA1 accumulates in the nucleus in response to hypoxia and TRAIL and enhances TRAIL-induced apoptosis in breast cancer cells pdf
... support the hypothesis that BRCA1 enhances TRAIL s ability to mediate apoptosis in breast cancer cell lines Discussion There is increasing interest in the association between hypoxia and BRCA1 ... induce apoptosis in breast cancer cells Therefore, we assessed the requirement for functional BRCA1 in TRAIL- stimulated apoptosis HCC1937 cells have...
Ngày tải lên: 30/03/2014, 03:20