Anti tumor properties of lactobacilli are mediated by immuno modulation and direct cytotoxicity

... ANTI- TUMOR PROPERTIES OF LACTOBACILLI ARE MEDIATED BY IMMUNO- MODULATION AND DIRECT CYTOTOXICITY CAI SHIRONG B.Sc (Hons), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... the anti- tumor properties of LGG and compare it with that of other lactobacillus strains The study is divided into main areas: I Immuno- modulation by lactobaci...

Ngày tải lên: 11/09/2015, 09:16

... specificities of the recombinant cysteine proteinases CPB of Leishmania mexicana, and cruzain of Trypanosoma cruzi, using fluorescent substrates containing non-natural basic amino acids Mol Biochem Parasitol ... proteinase, CPB, of Leishmania mexicana compared with cruzain, human cathepsin L and papain using substrates containing non-natural basic amino acids Eur J Bio...

Ngày tải lên: 23/03/2014, 13:20

... RGS are modulated by lipopeptides and LPS S Riekenberg et al to the number and length of their fatty acids and the amino acid sequence of their peptide tail To address TLR2 ⁄ 1- and TLR2 ... modulation of RGS1 and RGS2 in BMDM after stimulation with LP and LPS in more detail, because regulation of RGS1 and RGS2 after activation of different TLR may modify the e...

Ngày tải lên: 18/02/2014, 13:20

... focus on the biochemical properties of both splice variants of hGBP5, hGBP 5a ⁄ b (amino acids 1 -58 6) and the C-terminally truncated hGBP5ta (amino acids 1-489), using isothermal titration calorimetry ... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of p...

Ngày tải lên: 15/03/2014, 10:20

... expression of CLU or b-actin (E) Cytoplasmic (C) and nuclear (N) extracts isolated from confluent monolayers of HaCaT Neo and HaCaT c-fos cells and total proteins isolated from HaCaT cells and HaCaT cells ... period of days (C) Confluent monolayers of HaCaT Neo and HaCaT c-fos cells were cultured for 24, 48 and 72 h in the presence of serum, and...

Ngày tải lên: 16/03/2014, 02:20

... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganiz...

Ngày tải lên: 16/03/2014, 06:20

... single step process using thermal evaporation of silicon monoxide under argon atmosphere with traces of oxygen The nanowires were free from metal contaminations and showed blue photoluminescence at ... its simplicity and the low cost Conclusions Amorphous silicon dioxide nanowires of several hundred microns in length and tens of nanometers in diameter have been...

Ngày tải lên: 16/03/2014, 15:18

... of microstructural and electrochromic properties of the nanostructured tungsten oxides with mesopores from the TMDD surfactantassisted process The crystallization status, surface morphology and ... surfactant was used as a structural- directed template, mesoporous tungsten oxide was obtained by the modified sol–gel route The microstructural properties of the as -prep...

Ngày tải lên: 20/03/2014, 13:08

... determine the affinity of the latent state (E ¼ in the above scheme) of the ATPase for IF1: Kd is % lM This value is much higher than the Kd for the IF1 ATPase interaction in the absence of D~Hþ ... states of ATPase (or GTPase): where E is the only active form of ATPase During ATP hydrolysis, IF1 can bind to the ATPase both in the absence and in the...

Ngày tải lên: 23/03/2014, 12:20

... Conclusions We determined the redox properties of cytochrome P450BM3 by direct electrochemistry The holoenzyme response at a DDAB-modified EPG electrode was characterized by redox couples at )0.388 ... This type of plot can be used to calculate the electron transfer rate constant Ó FEBS 2003 Redox properties of cytochrome P450BM3 (Eur J Biochem 270) 4085 Fig Influ...

Ngày tải lên: 23/03/2014, 21:20

... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... contraindications dosing and recommended adjunct treatment see Tables 4-7) The finding that most myocardial infarctions were caused by thrombotic occlusion of a coronary a...

Ngày tải lên: 18/06/2014, 12:20

... primary colon carcinoma before start of the NK cell-based therapy, the anastomotic relapse before start of the NK cell-based therapy and the duodenom metastases after finishing the NK cell-based ... line phosphatase, γ-glutamine transferase, alanine aminotranferease (ALT), aspartate aminotransferase (AST), lactate dehydrogenase, Quick, and aPTT were determined before each le...

Ngày tải lên: 18/06/2014, 15:20

... indicates the importance of RGDechiHCit in the selective inhibition of endothelial aVb3 integrin Such inhibition opens new fields of investigation on the mechanisms of angiogenesis, offering clinical ... this article as: Santulli et al.: Evaluation of the anti-angiogenic properties of the new selective aVb3 integrin antagonist RGDechiHCit Journal o...

Ngày tải lên: 18/06/2014, 16:20

... models of neurodegenerative disease Neurodegeneration and PLA2 isoforms The survival- promoting and anti-inflammatory effects of CHEC-9 are most readily explained by the inhibition of PLA2 activity, ... systemic elevation of sPLA2s are associated with most forms of inflammation [1-5] The secreted isoforms are part of a growing family of PLA2 enzymes whose activity l...

Ngày tải lên: 19/06/2014, 22:20

... obvious that besides the size and shape of nanomaterials, the electronic properties can be further Page of 11 adjusted by applying the mechanical deformation Since BNNTs have some material properties ... increase under the larger strain However, the BO of the B-N bond parallel to the axial becomes smaller at larger strains The increase and decrease in the BO...

Ngày tải lên: 21/06/2014, 05:20