Synthesis, structural and photochemical 2+2 cycloaddition studies

... (Cu(I), Zn(II) and Cd(II)) and linear bridging ligands (cyanide).5a Similarly, dia topology also can be formed from tetrahedral bridging ligands and tetrahedral ligands In this way, 2D and 3D coordination ... rtct-tpcb and rcct-tpcb as their protonated salt (19, 20 and 21) in the VT-experiment in DMSO-d6 Selected bond distances and angles of 22 Selected bond distances and angl...

Ngày tải lên: 11/09/2015, 09:12

... N- (7- hydroxy -4- methyl- 8- coumarinyl)- L-serine N- 2( -pyridylmethyl)- aminoethanesulfonic acid N- (2- pyridylmethylene)-aminoethanesulfonic acid N- 2( -pyridylmethyl)- L-alanine N- 2( -pyridylmethyl)- b -alanine N- (2- pyridylmethylene)-b-alanine ... N- (2- pyridylmethylene)-b-alanine N- (2- pyridylmethyl)- L-glutamic acid N- (2- pyridylmethyl)- glyc...

Ngày tải lên: 14/09/2015, 08:47

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

... active domain homologues, in the bisphosphatase domain than in the kinase domain Conservation in the bisphosphatase domain is in the range 26–40% compared with just 13–28% in the kinase domain The ... Tb2, Lm2 and Tc2–1 PFK-2 and FBPase-2 domains in the C-terminal halves of the proteins are indicated as in Fig In the N-terminal halves, the ankyrin motifs with a primary str...

Ngày tải lên: 16/03/2014, 22:20

... b5 strand) of D3 and F27/Y289 (b2 strand), L67/M324, V70/I327 and L72/L328 (all in b4 strand) of B The second cluster consists of P6/M267, L10/ L271 (both in a-helix), V18/C279 (b1 strand), L32/F293 ... solution structures of the UBL domain of hHR23A/B bound to a UIM peptide of S5a [99,119] could be used to model the complex of hHR23A/B and ataxin-3 Similarly, the comple...

Ngày tải lên: 30/03/2014, 15:20

... utility of combining natural products containing inhibitors of both starch and sucrose absorption was strengthened when a combined starch- sucrose challenge, simulating a meal containing both, was influenced ... HG, Echard B, Bagchi D, Stohs S Inhibition by Natural Dietary Substances of Gastrointestinal Absorption of Starch and Sucrose in Rats and...

Ngày tải lên: 08/08/2014, 16:23

... this analysis by comparing only one HIV-1 and two HIV-2 strains we believe that the methodology developed here can be expanded to include comparisons between various strains of HIV-1 and HIV-2 Future ... virus type and type glycoproteins FEBS Lett 2000, 474:246-251 Puri A, Hug P, Munoz-Barroso I, Blumenthal R: Human erythrocyte glycolipids promote HIV-1 envelope glycoprot...

Ngày tải lên: 13/08/2014, 09:20

... PdCl ,11 4 -11 6 [Pd(allyl)Cl] , 12 5 - 12 6 PdCl (CH CN) , 83-84 ,11 7- 12 4 Pd(cod)CH Cl, 41, 118 -11 9, 12 7 - 12 8 PdCl (PhCN) ,95 ,11 9 Pd(cod)Cl , 41, 118 ,11 9, 12 8 -13 0 Pd(cod)Br , 41 Pd(cod)CH Br. 41 Ag(I)-NNHC complexes ... transition metal carbene complexes Complexes of Ni(II),78-79 Pd(II),80 Pt(II), 81 Au(I), 82- 91 Rh(I), 92- 10 1 Ir(I),96 ,10 0 ,1 02 Ru(II) ,10...

Ngày tải lên: 14/09/2015, 08:43

... 12. 63, 12. 60 1.53 15.10, 15.10 0.76 5.65, 5.05 - 12. 60, 12. 44 - 27 .3 27 .7 44.7 43.7 24 .5 24 .6 20 8.4 20 6.3 20 8.7 20 6.0 20 7.7 20 5.4 2. 3 02( 2) 2. 289(15) 2. 2 62( 8) 2. 267(8) 1.958(7) 1.971(6) 1.9 72( 3) ... 110.4(4) 111.4 (2) 111.4 (2) 130.7(5) 126 .3(4) 126 .9 (2) 128 .7 (2) 118.5(4) 123 .0(3) 122 .1(6) 123 .2( 5) 121 .61(15) 119.89(16) 122 .7 (2) 123 .8(3) 2. 5...

Ngày tải lên: 14/09/2015, 08:43

... NMR ( 125 . 03 MHz, D2O): δ 135 .2 (im- 13 C2), 133 .3 (CH2CH2CH=CH2), 122 .4 (im C4/5), 118.8 (CH2CH2CH=CH2), 49 .3 (CH2CH2CH2CH3), 48.8 (CH2CH2CH=CH2), 33 .8 (CH2CH2CH=CH2), 31 .2 (CH2CH2CH2CH3), 18.7 ... CH2CH2CH=CH2), 4. 93- 4. 82 (m, 2H, CH2CH2CH=CH2), 3. 75 (t, 2H, 3JHH = 7.4 Hz, CH2CH2CH=CH2), 3. 35 (q, 2H, 3JHH = 6. 93 Hz, CH2CH2CH=CH2), 3 .21 (s, 3H, CH3), 2. 31 (s, 6...

Ngày tải lên: 14/09/2015, 08:43

... obtained from bridge cleavage of dinuclear NSHC complexes of type [PdBr2(NSHC) ]2 (2. 2(a )2. 2(b) and 2. 17) complexes with different nucleophilic ligands Complexes 2. 9 -2. 16 are active in the Suzuki–Miyaura ... II, Sections 2. 4 -2. 8 discusses the synthesis and characterization of a range of mixed-NSHC-L Pd(II) complexes (L = phosphine, aromatic N-heterocycl...

Ngày tải lên: 14/09/2015, 08:43

... gi|566 926 44 ORF007L ORF012L SGIV protein 323 09 .26 iTRAQ ratio (MO18/ MOctrl) 0.379483 gi|566 926 49 ORFs/ Protein name Protein MW (Da) 129 768.6 0.6634 02 2 629 8 .25 0.579507 23 111.84 0.573601 gi|566 926 83 ... C., Wang F., and Hew C L 20 04 Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis Journal of...

Ngày tải lên: 14/09/2015, 14:11

... and Stirring Target Wet Grinding Sintering Pressing Drying Powder Calcination Grinding YES Single Phase Figure - Flow chart for standard preparation Nd0. 67Sr0. 33MnO3 target by solid-state reaction ... They are contact, tapping and non-contact mode We have 55 Chapter Two: Materials Preparation and Characterization Techniques adopted the tapping mode in our experiments In tappin...

Ngày tải lên: 16/09/2015, 15:54

... 131 .2, 124 .4, 122 .0, 117.5, 114.8, 106.4, 92. 4 (Ar-C), 68.8 (O-CH-), 31 .2, 28 .9, 28 .8, 28 .7, 28 .6, 28 .5, 28 .4, 25 .4, 21 .9 20 .2 (-CH2-), 13.8 (-CH3) MS (ESI): m/z: 434.3, 22 6.1, 23 8.1, 21 2.1, ... 131.5, 128 .6, 128 .2, 127 .2, 115.9, 114.6, 106 .2 (Ar-C), 71.7, 69.5 (O-CH-), 318, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 29 .0, 25 .9, 22 .6 (-CH2-), 13.9 (-CH3)...

Ngày tải lên: 16/09/2015, 17:11