Characterization of volatile compounds in selected citrus fruits from asia
... Summary In this research, the characterization of volatile compounds in selected citrus fruits from Asia, namely Pontianak orange from Indonesia, Mosambi from India and Dalandan from the Philippines ... are the main producers of citrus fruits, the southeastern part of Asia is believed to be the place of origin of citrus fruits There are many varieti...
Ngày tải lên: 11/09/2015, 09:11
... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables for estimation of 2-AP low concentration like aromatic rice The ... from Rice 3.4 Investigating the changes of 2-AP and other volatile compounds of rice in Bun processing Table The volatile co...
Ngày tải lên: 28/08/2013, 16:28
... from Rice 3.4 Investigating the changes of 2-AP and other volatile compounds of rice in Bun processing Table The volatile compounds in non-soaking and 12 hours soaking of Khao Dawk mali recorded ... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables fo...
Ngày tải lên: 19/03/2014, 16:20
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... months time [10 2] Acute cortical damage to auditory processing structures might be assessed objectively in a complementary manner, via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing ... Shappell SA, Brandt ME Psychophysiology of N200/ N400: A review and classification scheme Advances in Psychophysiology 19 91; 4:43 -10 6 Hoffman JE Event-related pot...
Ngày tải lên: 02/11/2012, 11:08
Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf
... residue in the N-terminal part of the peptide that binds in the with the C-terminal domain in CaM However in PhK5 Trp357 is found at the C-terminal end of the peptide This suggests that either PhK5 ... occurring on binding of the peptide and could indicate that the binding of PhK5 to Ca2+⁄ CaM is similar to that observed for Ca2+⁄ CaM binding to i...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and...
Ngày tải lên: 16/03/2014, 13:20
DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY pdf
... METHOD 525.2 DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY 1.0 SCOPE AND APPLICATION 1.1 This ... procedures for determination of organic compounds in finished drinking water, source water, or drinking water in any treatment stage The method is appl...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx
... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] su...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: Characterization of sequence variations in human histone H1.2 and H1.4 subtypes pptx
... arginine may affect the secondary structure of the C-terminal tail and the binding of H1.4 to chromatin, as arginine offers additional hydrogen-bonding abilities to DNA as compared to lysine ... cell lines was extracted by using the DneasyTM tissue kit (Qiagen, Hilden, Germany) and examined for sequence variations in codon 18 of H1.2 and in codon 174 of H1.4 To obt...
Ngày tải lên: 30/03/2014, 20:20
báo cáo hóa học: " Relationship between the EQ-5D index and measures of clinical outcomes in selected studies of cardiovascular interventions" pot
... near the upper limit of for the EQ-5D index [38], suggesting that the EQ-5D index does not discriminate well between good health states The ceiling effect and decreased sensitivity of the EQ-5D index ... with EQ-5D index in the CECaT groups than in most of the angina groups, perhaps reflecting greater physical disability in the angina groups all...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx
... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Genetic characterization of Measles Viruses in China, 2004" pptx
... the measles genotype circulating in China in 2004 and to complement the database of genetic characteristics of China measles strains during the control phase of the disease Table 1: Number of ... [8,27-29] Since WPRO, including China, has recently initiated a program to eliminate measles in 2012, maybe a variety of genotypes will be detected in China as the intensi...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Detection and characterization of translational research in cancer and cardiovascular medicine" potx
... network analysis – to investigate the emergence, structure, and content of translational research in biomedicine by comparing research in cancer and cardiovascular medicine Journal inter-citation is ... sole clinical mix journal in the set, maintains links to both the clinical domain and the molecular biology domain This journal plays a key role linking diverse resear...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: " Automatic Characterization of Myocardial Perfusion in Contrast Enhanced MRI" pptx
... processing She has published a number of proceedings papers and papers on medical image processing and tissue characterization Automatic Characterization of Myocardial Perfusion in Contrast Enhanced ... the intensity of the CM In our opinion, the use of 3D analysis of myocardial perfusion MRI in clinical environment requires both an improvement in MR device...
Ngày tải lên: 23/06/2014, 01:20