The plancherel formula of l 2(n 0 GIpsi) where g is a p adic group
The plancherel formula of l 2(n 0 GIpsi) where g is a p adic group
... will study in this paper Fix a minimal parabolic subgroup P0 as in the previous section A standard parabolic pair is a pair (P, A) consisting of a parabolic subgroup G ⊃ P ⊃ P0 and A0 ⊃ A ⊃ ZG ... representation on the space L2 (N0 \ G; ψ) where G is a quasi-split p- adic group and ψ a non-degenerate unitary character of the unipotent subgroup N0...
Ngày tải lên: 10/09/2015, 15:51
the strategic plan of heeap 2.0 project
... upgrading the infrastructure in cooperation with industry in order to improve the training quality that meets the demands of the high quality labor force – Facilitate the access of large numbers of ... number of English-speaking exchange students and faculty Potentially Compressed Set of Goals Recognition that must strategically execute successfully for HEEAP 2.0 to be...
Ngày tải lên: 14/08/2014, 00:21
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation
Ngày tải lên: 04/10/2012, 10:02
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... on the export of proteins that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence i...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: The plant S-adenosyl-L-methionine:Mg-protoporphyrin IX methyltransferase is located in both envelope and thylakoid chloroplast membranes pot
... MgPIXMT In spinach and A thaliana chloroplasts, the MgPIXMT protein is present in an active form in both thylakoids and envelope membranes Its size is apparently identical in both types of membranes ... MgPIXMT in chloroplast membranes (A) Analysis of spinach chloroplast envelope and thylakoids fractions The fractions were analyzed by SDS/PAGE and C...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: The changing patterns of covalent active site occupancy during catalysis on a modular polyketide synthase multienzyme revealed by ion-trap mass spectrometry pptx
... 55 N A N A 0a 0a N A N A 58 4 9a 2 8a a Methylmalonyl-CoA Malonyl-CoA Propionyl-CoA; methylmalonyl-CoA; NADPH Butyryl-CoA; methylmalonyl-CoA; NADPH Valeryl–CoA; methylmalonyl-CoA; NADPH Propionyl-CoA; ... chain-extension AT and ACP domains was considerably less than 100% As the AT-catalyzed reaction is readily reversible, the extent of loading of methylmalonate on the AT a...
Ngày tải lên: 16/03/2014, 03:20
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... that the NADP+ oxidation reaction is highly regiospecific Kinetics of NADPO formation as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation...
Ngày tải lên: 16/03/2014, 11:20
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... Laboratory evaluation included liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, ... method The starting point for survival analysis was date of diagnosis of NAFLD Patient follow -up was extended up to April 200 8 The end-points for survival analysis...
Ngày tải lên: 22/03/2014, 10:20
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot
... 522 5 SRPK1 /1a inhibition by interaction with SAFB1 /2 19 20 21 22 23 24 25 26 27 28 29 30 D Tsianou et al lamin B receptor by a serine ⁄ arginine kinase and p34(cdc2) J Biol Chem 27 2, 620 8–6 21 3 ... GST– GST– SAFB1C SAFB1CΔRE SAFB2C GST Anti-GST FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a Eluate FLAG–SRPK1 Fig Binding of the...
Ngày tải lên: 30/03/2014, 01:20
Assessment Of The Comparative Advantage Of Various Consumer Goods Produced In India Vis-à-vis Their Chinese Counterparts pptx
... industry CONSUMER DURABLE INDUSTRY IN INDIA AND CHINA - Comparison of the market across all six categories in India and China ANALYZING CHINA’S GROWTH - Analysis of the growth of manufacturing in China ... operations in India ADVANTAGE CHINA Final testing Software loading CHINA CHINA • • This process is typically not a bottleneck China has shortage of technical t...
Ngày tải lên: 30/03/2014, 06:20
báo cáo hóa học:" The adequacy of policy responses to the treatment needs of South Africans living with HIV (1999-2008): a case study" doc
... Historically, the first attempts at valuing lives saved used the human capital approach In this approach, a human being is regarded as an asset with a capital value based (as is the case for any ... Comprehensive Plan: planned number of patients on ARVs and associated costs and total costs Year New cases starting ARVsa Total cases on ARVsa Total ARV diagnostic costs (ZAR milli...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học: " The comparative burden of mild, moderate and severe Fibromyalgia: results from a cross-sectional survey in the United States" pdf
... ranging from (indicating no pain) to 10 (indicating pain as bad as you can imagine) Higher scores indicate greater pain severity Based on previous analyses, scores of to are considered mild, to are ... was classified as mild, 39 to < 59 was classified as moderate, and 59 to 100 was classified as severe [20] Statistical significance was evaluated at the 0.05 level The data wer...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo lâm nghiệp: "Effect of contrasting water supply on the diameter growth of Norway spruce and aspen in mixed stands: a case study from the southern Russian taiga" pot
... Stand seasonal growth pattern in 2000 Seasonal increment of basal area in spruce represented over 80% of the entire stand basal area increment (as indicated by Comparison of seasonal tree radial ... showed the transformation of secondary stand with domination of aspens into the stand with dominant spruce and significant admixture of alder in wet part of the...
Ngày tải lên: 08/08/2014, 00:22
Báo cáo toán học: "The number of F -matchings in almost every tree is a zero residue" ppt
... of F -matchings in each such class is a zero residue Indeed, the number of F -matchings in a given class Ci is precisely the number of F -matchings in the forest remaining from T after removing ... An F -matching in G is a subgraph of G consisting of pairwise vertex disjoint copies of F We say that the F -matching is induced in...
Ngày tải lên: 08/08/2014, 12:23
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
... increased optimism for the use of gene transfer in the treatment of chronic articular disease Indeed, IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a ... the cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Material...
Ngày tải lên: 09/08/2014, 01:23