Structure and mechanism of hormone perception and signal transduction by abscisic acid receptors

Structure and mechanism of hormone perception and signal transduction by abscisic acid receptors

Structure and mechanism of hormone perception and signal transduction by abscisic acid receptors

... complex structures 96 Figure 38 Cartoon summary of the gate-latch-lock mechanism of ligand perception and signal transduction by the PYL ABA receptors 99 Figure 39 Mutations in the PYR1 latch and ... mechanism of signalling by ABA receptors 78 3.6 Selective pyrabactin activation and antagonism of PYLs 83 3.6.1 Mechanism of pyrabactin-mediated receptor activ...

Ngày tải lên: 10/09/2015, 09:26

171 350 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...

Ngày tải lên: 07/03/2014, 16:20

12 595 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganiz...

Ngày tải lên: 16/03/2014, 06:20

14 420 0
Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

... bacterially expressed rPhl p and exposed to dot-blotted bacterial recombinant (PrPhl p 1+ ) or eukaryotic recombinant Phl p (ErPhl p 1+ ) PrPhl p 1- and ErPhl p 1- show the IgE binding without preadsorption ... p (nLol p 1) , natural Phl p (nPhl p 1) , eukaryotic recombinant Phl p (ErPhl p 1) and bacterial recombinant Phl p (PrPhl p 1)...

Ngày tải lên: 16/03/2014, 18:20

11 355 0
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: fine-tuning of autophagy in Caenorhabditis elegans homeostasis doc

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: fine-tuning of autophagy in Caenorhabditis elegans homeostasis doc

... death-associated protein kinase (DAPK) in the regulation of autophagy Fine-tuning of autophagy in C elegans homeostasis is particularly interesting DAPK is a serine ⁄ threonine kinase originally isolated ... responding to growth factors and amino acid signaling, (b) AMP-activated protein kinase, which activates autophagy through the inhibition of mTOR sign...

Ngày tải lên: 29/03/2014, 08:20

8 376 0
Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and functio...

Ngày tải lên: 30/03/2014, 03:20

8 496 1
Plant physiology - Chapter 14 Gene Expression and Signal Transduction potx

Plant physiology - Chapter 14 Gene Expression and Signal Transduction potx

... pathways in which one or Gene Expression and Signal Transduction (A) Tryptophan operon 5′ DNA Regulatory gene i Transcription Promoter p Operator o 3′ Gene E Gene D Gene C Gene B Gene A Transcription ... on other genes Other important protooncogenes that encode nuclear transcription factors include MYC and MYB Both phytochrome (see Chap- Gene Expression and Sign...

Ngày tải lên: 07/03/2014, 21:20

30 567 1
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: additional roles beyond cell death ppt

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: additional roles beyond cell death ppt

... responses by death- associated protein kinase Proc Natl Acad Sci USA 106, 1457–1461 Michie AM, McCaig AM, Nakagawa R & Vukovic M (2009) Death- associated protein kinase (DAPK) and signal transduction: ... elegans during starvation Genes Dev 21, 2161–2171 Kang C & Avery L (2009) Death- associated protein kinase (DAPK) and signal transduction: fine-tuning...

Ngày tải lên: 29/03/2014, 08:20

10 270 0
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: blebbing in programmed cell death docx

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: blebbing in programmed cell death docx

... actin cortex under the membrane of blebs in filamin-deficient blebbing cells has not been examined in blebs of cells undergoing cell death Although the proteins involved in the execution of blebbing ... tropomyosin and the actin-bundling protein, a-actinin Finally, myosin is recruited and is concentrated in a few distinct dots along the cortex [4] When examined by scanning...

Ngày tải lên: 29/03/2014, 08:20

8 285 0
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: regulation in cancer ppt

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: regulation in cancer ppt

... (BMS-354825) tyrosine kinase inhibitor suppresses invasion and induces cell cycle arrest and apoptosis of head and neck squamous cell carcinoma and non-small cell lung cancer cells Clin Cancer Res 11, ... little clinical benefit in the treatment of solid tumours and are now being tested in combination therapies [47] Tyrosine kinase inhibitors are widely and successfully...

Ngày tải lên: 29/03/2014, 08:20

7 427 0
Báo cáo khoa học: M1 – Peptidomimetics and Signal Transduction Inhibition potx

Báo cáo khoa học: M1 – Peptidomimetics and Signal Transduction Inhibition potx

... movens’’ of Ab 1–4 2 toxicity In fact, both Ab 1–4 0 and 1–4 2 have been shown to form ion channels in planar bilayer membranes.[1, 2] Besides, Ab 1–4 2 has been shown to perturb and increase the ... activation of innate and adaptive immune responses, inflammation and prevention of apoptosis NF-jB1 and NF-jB2 require – proteolytic processing to produce the mature p50 and...

Ngày tải lên: 30/03/2014, 20:20

20 359 0
Báo cáo y học: "Cancer, oncogenes and signal transduction" pps

Báo cáo y học: "Cancer, oncogenes and signal transduction" pps

... that asymmetric localization of Numb requires both a temporal signal mediated by the activation of Aurora by the Cdc2 cell-cycleregulatory kinase as well as a spatial signal provided by a complex ... of years ago much excitement was caused by the finding that most melanomas are caused by mutations in the B-Raf kinase that result in activation of the ERK pathway Remarkably, both activating...

Ngày tải lên: 09/08/2014, 20:20

3 178 0
báo cáo khoa học: " Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid" pdf

báo cáo khoa học: " Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid" pdf

... important regulators of the transcripts of WRKY2 by ABA treatment Our results suggest that WRKY2 transcription factor mediates seed germination and postgermination developmental arrest by ABA Methods ... important regulator of postgermination developmental arrest mediated by ABA Postgermination proteolytic degradation of the essential ABI5 transcriptio...

Ngày tải lên: 12/08/2014, 03:20

14 250 0
Báo cáo y học: "Gene regulation and signal transduction in the immune system" pptx

Báo cáo y học: "Gene regulation and signal transduction in the immune system" pptx

... promoting B-cell development by restraining the expression of pro-myeloid factors (such as Gfi1), and acting directly to induce the recombinase (Rag) genes and thereby recombination at the immunoglobulin ... the immunoglobulin heavy-chain locus Interestingly, Ikaros was found to bind at pericentromeric satellite DNA and could therefore play a role in the silencing of genes e...

Ngày tải lên: 14/08/2014, 20:22

4 268 0
w