QUANTITATIVE CHEMICAL PROTEOMICS INVESTIGATIONS OF TARGETS OF ANDROGRAPHOLIDE AND PROTEOLYSIS OF AUTOPHAGY

... unbiased and specific drug target profiling Using this method, a spectrum of specific targets of Andrographolide (Andro) was identified, revealing the mechanism of action of the drug and its potential ... anti-inflammation and anti-cancer effects, in live cancer cells We identified a spectrum of specific targets of Andro, which furthered our understanding of the mech...

Ngày tải lên: 10/09/2015, 09:26

... describe the design and synthesis of OrlistatTM -like natural product -based probes (Chapter 2, & 4), K11777 -like drug candidate -based probes (Chapter 5) and azanitrile-containing small molecules (Chapter ... 1.2 Activity- Based Protein Profiling (ABPP) 1.2.1 Introduction 1.2.2 Activity- Based Probe Design 1.2.3 Bioorthogonal Chemistry in ABPP 10 1.2.4 Application...

Ngày tải lên: 09/09/2015, 18:54

... good target for drug development Recently the 3D structures of Uu-TK and cytosolic hTK1 were determined [14,15] The structure of these thymidine kinases differs significantly from the earlier ... nucleotide-binding region in the substrate complex (orange) and the inhibitor complex (olive) The side chain of the catalytic Glu97 has different positions in...

Ngày tải lên: 30/03/2014, 11:20

Ngày tải lên: 04/06/2014, 15:22

... The Project Gutenberg EBook of An Introductory Course of Quantitative Chemical Analysis, by Henry P Talbot This eBook is for the use of anyone anywhere at no cost and with almost no restrictions ... insure permanently work of a high grade, while neglect of them will often lead to disappointment and loss of time ACCURACY AND ECONOMY OF TIME The fundamental conception...

Ngày tải lên: 28/06/2014, 19:20

... Wee Liang for helping me in the synthesis of the NDA-AD cross-linker, Derek for helping me in the synthesis of the dialdehyde and Liquian and Hongyan for their help in the peptide synthesis - ... expression levels of the proteins, relatively newer approaches such as Activity- Based Protein Profiling (ABPP) provide more insights into the functional states of...

Ngày tải lên: 11/09/2015, 09:58

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... catalytic residues: E52 and R105 It is evident from the kinetic results that mutation of E52 changes only the catalytic rate For the E52D mutant the Km value was approximately the same as for the wild-type ... mutation of deoxyribonucleoside kinase L Egeblad-Welin et al Human deoxyribonucleoside kinases are targets for the chemotherapeutic treatment of...

Ngày tải lên: 19/02/2014, 02:20

... this hypothesis, the influence of the concentrations of NADP+ and MEP 5, the substrates of the reverse reaction, and of NADPH and DXP 3, the products of the reaction, on the total amount of NADPH ... by the DXR by the conversion of MEP into DXP Rearrangement of DXP to 2-C-methyl-D-erythrose4 -phosphate 4: the role of NADPH The conversion of DXP into M...

Ngày tải lên: 21/02/2014, 03:20

... modestum subunit c in chloroform/methanol/water (4 : : 1) Samples of mM unlabelled subunit c of Propionigenium modestum in C2 HCl3 /C2 H3OH/H2O (4 : : 1), 25 mM D11-Tris/HCl were prepared to test the ... helices in the structure in chloroform/methanol/water (4 : : 1) [23], amino-acid sequence of P modestum subunit c...

Ngày tải lên: 08/03/2014, 10:20

... been paid to the physical and chemical properties of metal-organic precursors used for deposition of the layers with liquid-delivery MOCVD A study of SrRuO3 layers in terms of the surface morphology, ... γfilm and γsubs are the surface free energies of film and substrate, respectively, and γi the free energy of the interface The latter quantity depends on the strai...

Ngày tải lên: 14/03/2014, 19:20

... evoluzione ambientale olocenica della pianura costiera ferrarese e dell’antistante mare adriatico Conferenza Le pianure: Conoscenza e salvaguardia; il ruolo delle scienze della terra, Ferrara – (abstract ... della Pianura Padana—uno strumento per valutare la qualita’ dell’ambiente Conferenza Le pianure: Conoscenza e salvaguardia; il ruolo delle scienze della terra, Ferrara pp 131 – 133 (a...

Ngày tải lên: 15/03/2014, 23:22

... Analysis of signaling networks using protein arrays H Voshol et al a contextual understanding of the molecular mechanisms of disease, but also has the potential to facilitate the validation of ... possible Arguably, signaling pathways are currently the best practical translation of ‘physiology’ because Analysis of signaling networks using protein arrays t...

Ngày tải lên: 16/03/2014, 00:20

Ngày tải lên: 16/03/2014, 11:45

... al / Chemical Physics Letters 411 (2005) 198–202 201 Fig TEM images of silicon nanostructures growth by different pyrolysis time of silane (a) a triangle -shaped silicon tip grown on a CNT by 30-min ... conclusion, by chemical vapor deposition of silane, the large-scale SiNWs were grown under the catalysis of Fe particles at the lower temperature – 450 °C These...

Ngày tải lên: 16/03/2014, 15:06