New stilbenoids isolated from fungus challenged peanut seeds and their bioactivity evaluations

... al., 2011) 2.3 Stilbenoids isolated from peanuts and their bioactivities 2.3.1 Stilbenoids isolated from peanuts Stilbenoids are a common structural motif of phytoalexins found in peanuts (Arachis ... anti-diabetic bioactivity of stilbenoids ……………………….14 2.2.5 The anti-obesity bioactivity of stilbenoids ……………………… 16 2.3 Stilbenoids isolated from peanuts and th...

Ngày tải lên: 10/09/2015, 09:24

... AND METHODS Chemical analysis of glycolipids Plerocercoids and adult worms of D hottai Plerocercoids of D hottai were collected from Japanese surf smelts, Hypomesus pretiosus japonicus Some plerocercoids ... adults In considering the overall ceramide composition of D hottai GSLs, we noticed that adults have no hydroxy fatty acid, plerocercoids have predominan...

Ngày tải lên: 24/03/2014, 03:21

... M and Collins, M D Molecular taxonomic Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and ... profile using the restriction enzymes RsaI and AvaII RFLP analysis of the 16S rRNA gene had Identification and epidemiological characterization of Strept...

Ngày tải lên: 07/08/2014, 17:22

... isolated from gastric juice of goat 2.2.3 Identification of bacteria by PCR method 2.2.4 Studying on a combination between ruminal bacteria isolated from gastric juice of goat and cow in vitro ... Studying on combination ability of ruminal bacteria isolated from goat and cow in vitro Objective: To evaluate generally cellulose degra...

Ngày tải lên: 06/10/2015, 13:04

... constituents of the seeds of Psoralea corylifolia on skin cells Figure 2.1: Outline of experimental approaches to investigate the effects of selected constituents from the seeds of Psoralea corylifolia on ... Effect of Syn2 (6) on proliferation of human skin fibroblast cells (NF103, P6) .61 Figure 4.10: Effect of Fc-8b, Fc-8f, and Syn1 (5) on...

Ngày tải lên: 27/11/2015, 11:11

... Resveratrol Derivatives from Hopea Stem Bark 20 CONCLUSION In this paper, we concluded that resveratrol derivatives isolated from the stem bark of Hopea consist of dimer, trimer and tetramer ... that of vaticanol G isolated from Vatica rassak.8 Complete assignment of all Resveratrol Derivatives from Hopea Stem Bark 16 proton-bearing carbon signals wer...

Ngày tải lên: 07/08/2014, 14:20

... modular domains and phosphopeptide-binding domains and their binding specificities related to proline- rich motifs Proline- rich motifs often appear in cluster in a much longer proline- rich region ... domains and a set of proline/ serine -rich disordered regions This index is used to predict long proline- rich disordered regions containing multiple serin...

Ngày tải lên: 09/09/2015, 10:14

... UcPLA2 (Fig 3A) Other known cnidarian PLA2s, such as those from the hydrozoan Hydra magnipapillata [34] and the sea anemones A pallida [16,17] and B caissarum [19], as well as the PLA2 from the jellyfish ... Pacific sea anemone Urticina crassicornis (UcPLA2) This new PLA2 (UniProt UcPLA2 A7 LCJ2) is homologous with AcPLA2, and, with regard to many structural feat...

Ngày tải lên: 06/03/2014, 11:20

... it was suggested that amine oxidases are enzymes of cellular amino acid catabolism, comprising potential candidates for a mechanism that catalyses nitrogen mineralization from amino acids at the ... organism In conclusion, in the present study, a novel cytotoxic protein was isolated from the death cap and characterized The physico-chemical, chemical and biological ch...

Ngày tải lên: 29/03/2014, 08:20

... FLS-F, 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGA...

Ngày tải lên: 12/08/2014, 03:21

... prevalence of B19 infection in livers from patients with fulminant hepatitis and biliary atresia Interestingly, all fulminant hepatitis patients infected with B19 had the replicative form of B19 mRNA ... prevalence of B19 infection not only in fulminant hepatitis patients, but also in biliary atresia patients However, all fulminant hep...

Ngày tải lên: 26/10/2012, 10:03

Ngày tải lên: 16/12/2012, 15:24

... number 629 Genotyping of Clostridium perfringens isolated from cattle and pigs with diarrhea in Hanoi and surrounding areas, Vietnam 3.2 Genotyping of C perfringens the toxicity of C perfringens ... Genotyping of Clostridium perfringens isolated from cattle and pigs with diarrhea in Hanoi and surrounding areas, Vietn...

Ngày tải lên: 29/08/2013, 08:14

... menaquinone during the electron transport in Wolinella succinogenes Biochim Biophys Acta 1184, 219226 17 Unden, G & Kroger, A (1982) Reconstitution in liposomes of the ă electron transport chain ... amounts of TPP+ before the electron transport was started by the addition of the substrates Dw was calculated from the TPP+ concentrations within the...

Ngày tải lên: 21/02/2014, 03:20

... known They could be synthesized in the cytosol by glycosyltransferases which add glucosyl or galactosyl residues to the free trehalose that arises from trehalose phosphate by the action of the specific ... and isolated from the cytoplasm of M smegmatis, will also be found as part of the cell wall components of this organism All trehalose-containing structures rep...

Ngày tải lên: 22/02/2014, 07:20