A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity

A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity

A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity

... crystalline state as they contain saturated and unsaturated acyl chains of variable length in which the acyl chains are fluid and disordered In the absence of other lipids, membranes containing ... 1.8) The lipid moiety can vary in terms of chain length of the fatty acids and in the degree of saturation and hydroxylation of the sphingoid base Also, vari...

Ngày tải lên: 10/09/2015, 09:01

260 334 0
báo cáo khoa học: " Assessing the role of syringe dispensing machines and mobile van outlets in reaching hard-to-reach and high-risk groups of injecting drug users (IDUs): a review" ppt

báo cáo khoa học: " Assessing the role of syringe dispensing machines and mobile van outlets in reaching hard-to-reach and high-risk groups of injecting drug users (IDUs): a review" ppt

... on dispensing machines and 22 on mobile vans Results Introduction of dispensing machines and mobile vans to NSP Syringe dispensing machines were first introduced in Copenhagen, Denmark in June ... Netherlands Milan, Italy Sydney, Australia Berlin, Germany Berlin, Germany New South Wales, Australia Perth and Adelaide, Australia Hindelbank, Switzerland Realta, Swit...

Ngày tải lên: 11/08/2014, 18:20

9 422 0
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx

Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx

... antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosylation at asparagine ... purposes) Interaction of antithrombin with endothelium The affinity of antithrombin (AT) to thrombin and its enzymatic inhibition is increased by binding of AT with t...

Ngày tải lên: 12/08/2014, 23:21

9 393 0
The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury

The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury

... disruption of the capillary-alveolar barrier function results in the leakage of inflammatory exudates, edema fluid and plasma proteins into the lung interstitium and alveolar spaces and the collapse of ... et al, 2010) 2.5 Influenza virus and host defences During an acute influenza virus infection, both arms of immunity: Innate and adaptive, are importa...

Ngày tải lên: 13/10/2015, 16:41

181 496 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20

11 549 0
the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

... The Role of Neutrinos, Strings, Gravity, and Variable Cosmological Constant in Elementary Particle Physics This page intentionally left blank The Role of Neutrinos, Strings, Gravity, and Variable ... N Kursunoglu, Stephan Mink, and Arnold Perlmutter Plenum Press, 2001 The Role of Neutrinos, Strings, Gravity, and Variable Cosmologica...

Ngày tải lên: 24/04/2014, 17:07

284 2,2K 0
báo cáo hóa học: " A cohort study of short-term functional outcomes following injury: the role of pre-injury sociodemographic and health characteristics, injury and injury-related healthcare" pot

báo cáo hóa học: " A cohort study of short-term functional outcomes following injury: the role of pre-injury sociodemographic and health characteristics, injury and injury-related healthcare" pot

... this article as: Langley et al.: A cohort study of short-term functional outcomes following injury: the role of pre -injury sociodemographic and health characteristics, injury and injury- related healthcare ... we asked them to characterize their pre -injury functional status for each dimension Explanatory Variables Our review of the literatur...

Ngày tải lên: 20/06/2014, 15:20

12 472 0
Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc

Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc

... predicting time to acute organ failure and risk of in- hospital death Diabetes mellitus Body mass index Time to acute organ failure, hazard ratio (95% CI) Risk of in- hospital death during acute organ ... in our analytic cohort Outcome variables The primary outcomes of interest were the risk of the development of acute organ failure within...

Ngày tải lên: 13/08/2014, 03:20

9 501 0
the role of supply chain processes and information sharing in supply chain management

the role of supply chain processes and information sharing in supply chain management

... has yet investigated the role of information sharing and supply chain processes in supply chain management under alternative supply chain dynamism that includes both supply chain business environment ... manufacturing firms make investment in information sharing and supply chain processes? Especially, how should firms balance the investment in...

Ngày tải lên: 02/11/2014, 00:47

265 543 0
The role of adenosine, adenosine receptors and transporters in the modulation of cell death

The role of adenosine, adenosine receptors and transporters in the modulation of cell death

... The number of amino acids comprising the extra- and intracellular loops and the extracellular N-terminal and intracellular C-terminal regions of the bovine A1 receptor are indicated in parentheses ... during the adenosine- induced apoptosis in 163 BHK cells Fig 3.70 Activation of caspase during the adenosine- induced apoptosis 165 in BHK cells Fig 3.71 Caspase-...

Ngày tải lên: 11/09/2015, 16:07

278 355 0
The role of small GTPases rap1 and rhoa in growth hormone signal transduction

The role of small GTPases rap1 and rhoa in growth hormone signal transduction

... mechanism of growth hormone signal transduction 1.4.1 Growth hormone receptor (GHR) and protein tyrosine kinase JAK2 The cellular effects of GH are initiated by the binding of GH to the extracellular ... signaling The aim of this project was to investigate the role of small GTPases Rap1 and RhoA in GH signal transduction Rap1, a close relat...

Ngày tải lên: 16/09/2015, 17:13

246 351 0
The role of health related, motivational and sociodemographic

The role of health related, motivational and sociodemographic

... representation of the Germanspeaking part of Switzerland Questionnaire The questionnaire contained questions about all of the variables and constructs listed in Fig Most of the predictor concepts and the ... on the package as is mostly the case in Switzerland might be problematic from a public health perspective On the one hand, this format may decrease understan...

Ngày tải lên: 08/04/2014, 17:00

8 272 0
A study on issuing corporate bond the case of bank for investment and development of Vietnam -BIDV

A study on issuing corporate bond the case of bank for investment and development of Vietnam -BIDV

... From the reasons, the final thesis titled A STUDY ON ISSUING CORPORATE BOND - THE CASE OF BANK FOR INVESTMENT AND DEVELOPMENT OF VIET NAM” The study provided a real case and updated international ... recommendations on the bond issuance and solutions to develop the primary bond market as well The final thesis aim to: Introduce the int...

Ngày tải lên: 26/03/2015, 08:48

109 701 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx

Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx

... oxygen binding with heme, and in turn, can change the affinity of Hb for oxygen The majority of mutations affecting oxygen affinity result in high affinity Hb variants which result in leftward ... along the interface of alpha and beta chains of the Hb tetramer Several hemoglobin variants have substitutions affecting this interface All these substitutions can affect th...

Ngày tải lên: 08/08/2014, 16:23

5 419 0
Từ khóa:
w