Guanidine catalyzed enantioselective mannich reaction towards the synthesis of amino acids

Guanidine catalyzed enantioselective mannich reaction  towards the synthesis of  amino acids

Guanidine catalyzed enantioselective mannich reaction towards the synthesis of amino acids

... GUANIDINE CATALYZED ENANTIOSELECTIVE MANNICH REACTION: TOWARDS THE SYNTHESIS OF  -AMINO ACIDS PAN YUANHANG (BSc., Zhejiang University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... the enantioselecitive decarboxylative Mannich and amination reactions of MAHTs catalyzed by bicyclic guanidine in the following chapters The mechanistic stud...

Ngày tải lên: 10/09/2015, 08:31

240 360 0
Bicyclic guanidine catalyzed enantioselective isomerization reactions

Bicyclic guanidine catalyzed enantioselective isomerization reactions

... BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ISOMERIZATION REACTIONS LIU HONGJUN 2010 BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ISOMERIZATION REACTIONS LIU HONGJUN ... this study is to develop highly enantioselective isomerization reactions catalyzed by chiral bicyclic guanidines A chiral bicyclic guanidine was found to catalyze the isomerization o...

Ngày tải lên: 11/09/2015, 09:17

197 273 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 1

Guanidine catalyzed enantioselective desymmetrization of meso aziridines 1

... and co-workers Scheme 1. 5 Proposed mechanism of gadolinium -catalyzed desymmetrization of meso- aziridines with TMSCN Scheme 1. 6 Gadolinium -catalyzed desymmetrization of meso- aziridines with TMSCN ... 1. 12 Chiral phosphoric acid -catalyzed desymmetrization of mesoaziridines with TMS-SPh developed by Della Sala and co-workers Scheme 1. 13 Chiral phosphoric acid...

Ngày tải lên: 11/09/2015, 10:05

12 232 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 2

Guanidine catalyzed enantioselective desymmetrization of meso aziridines 2

... 79b 79c 79d 25 25 -20 -20 -20 -20 -20 -20 24 24 24 24 20 20 20 20 100 100 90 90 94d 94d 89d 92d 15 13 30 17 33 2 a All reactions were performed with 0. 02 mmol of aziridine, 0.04 mmol of thiol and ... racemization Scheme 2. 12 Chiral bicyclic guanidine catalyzed Diels-Alder reactions of anthrones .21 32 Chapter 2. 1 .2 Bicyclic guanidine catalyzed enantioselec...

Ngày tải lên: 11/09/2015, 10:05

35 261 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 3

Guanidine catalyzed enantioselective desymmetrization of meso aziridines 3

... Structure of fluoxetine Scheme 3. 4 Synthesis of carbodithioic acid esters of fluoxetine 63 Chapter 3. 2 Guanidine catalyzed enantioselective desymmetrization of meso- aziridines with in situ generated ... Table 3. 3 Chiral guanidine 79b catalyzed desymmetrization of various meso N-acyl aziridines 12 with amine and CS2 a 12 (R =3, 5-dinitrobenzoyl) 96 x mol%...

Ngày tải lên: 11/09/2015, 10:05

16 232 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 4

Guanidine catalyzed enantioselective desymmetrization of meso aziridines 4

... 148 .7, 162.1 FTIR (film): 928, 1 045 , 1216, 142 5, 1520, 1 643 , 2977, 3020, 344 6 cm-1 LRMS (ESI) m/z 44 2.1 (M-H+), HRMS (ESI) m/z 44 2.0 044 (M-H+), calc for C17H14Cl2N3O5S 44 2.0037 The enantiomeric excess ... 28.2, 28 .4, 54. 0, 57.6, 83.5, 84. 7, 128.1, 129 .4, 130.3, 130.9, 133 .4, 137.2, 141 .7, 144 .3, 168.1, 169.1 FTIR (film): 758, 928, 1 045 , 1159, 1216, 1 349 , 142 4, 1522,...

Ngày tải lên: 11/09/2015, 10:05

39 211 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 5

Guanidine catalyzed enantioselective desymmetrization of meso aziridines 5

... 64.0, 124.3, 1 25. 6, 126.7, 127.7, 128 .5, 129 .5, 130 .5, 132 .5, 134 .5, 1 35. 5, 140.0, 1 65. 4, 189.3, 191.1 FTIR (film): 1020, 1182, 1228, 1271, 1 456 , 152 5, 16 45, 1692, 17 45, 2 856 , 2934, 3 057 cm-1 LRMS ... NMR ( 75 MHz, CDCl3, ppm): δ 14.4, 24.1, 49.4, 64.0, 1 25. 9, 128.7, 133.1, 137.3, 140.1, 153 .4, 1 65. 4, 189.6, 191.0 FTIR (film): 1016, 1 155 82, 1218, 1286, 1380, 1 452 ,...

Ngày tải lên: 11/09/2015, 10:05

25 214 0
Bicyclic guanidine catalyzed enantioselective allylic addition reactions

Bicyclic guanidine catalyzed enantioselective allylic addition reactions

... BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ALLYLIC ADDITION REACTIONS WANG JIANMIN 2011 BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ALLYLIC ADDITION REACTIONS WANG JIANMIN ... develop highly enantioselective allylic addition reactions catalyzed by chiral bicyclic guanidines A chiral bicyclic guanidine was found to catalyze a direct asymmetric...

Ngày tải lên: 12/09/2015, 09:07

260 230 0
Chiral guanidine catalyzed enantioselective protonation reactions

Chiral guanidine catalyzed enantioselective protonation reactions

... Chapter 2 Enantioselective Protonation Reactions Catalyzed by Chiral Bicyclic Guanidine Enantioselective Protonation Reactions Catalyzed by Chiral Bicyclic Guanidine 2.1 Catalytic Enantioselective Protonation Reactions ... List of Abbreviations  Chapter 1 Chiral Guanidines Catalyzed Enantioselective Reactions Chiral Guanidines Catalyzed Enantioselective Reactions 1  1.1 Introduction  2  1.2...

Ngày tải lên: 12/09/2015, 10:17

421 227 0
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi

This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi

... previously in the thesis, the last aims of the questionnaire is to find out the teachers’ judgments on the applicability of the process approach in teaching writing in given context It is interesting ... text is completed PREWRITING COMPOSING/ DRAFTING REVISING EDITING PUBLISHING Figure 2: Model of process approach Since it lays the emphasis o...

Ngày tải lên: 07/09/2013, 13:51

31 561 2
THE URBAN AUDIT Towards the Benchmarking of Quality of Life in 58 European Cities docx

THE URBAN AUDIT Towards the Benchmarking of Quality of Life in 58 European Cities docx

... provided from the Urban Audit Web Site to the sites of participating cities Individual City Audits for each of the 58 Urban Audit Cities These Individual City Audits elaborate on the information ... provided the source is acknowledged Foreword This is the first edition of the Urban Yearbook It presents the main results of the pilot phase of the...

Ngày tải lên: 06/03/2014, 23:20

176 397 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
Báo cáo Y học: Genomic organization of MUC4 mucin gene Towards the characterization of splice variants potx

Báo cáo Y học: Genomic organization of MUC4 mucin gene Towards the characterization of splice variants potx

... with the nucleotide sequence of the MUC4 gene allowed us to establish the nature of the mechanisms responsible for the diversity of transcripts They were generated by the combination of either ... located in the 3¢ region but also for two of them by deletion of the central repetitive domain Until now, because of the lack of knowledge on the genomic o...

Ngày tải lên: 17/03/2014, 23:20

8 341 0
facile route to the synthesis of porous - fe2o3 nanorods

facile route to the synthesis of porous - fe2o3 nanorods

... on the synthesis of porous ␣-Fe2 O3 nanorods have been published to date [46] Owing to their specific characteristics and promising applications exploring proper methods for the synthesis of nanoscale ... nanostructures The presence of a rod-like micelle of the surfactant in solution promoted the formation of one-dimensional rod-like structures Herein, we report...

Ngày tải lên: 19/03/2014, 16:48

6 507 0
w