Knowledge guided docking of flexible ligands to protein domains
Knowledge guided docking of flexible ligands to protein domains
... and torsion angle Schematic model of the binding of WW domains to ligands Schematic model of the binding of SH2 domains to ligands Schematic model of the binding of SH3 domains to ligands ... performance of various docking programs 3.3 Performance of Protein Docking Methods 29 Table 3.1: Summary of test cases and docking performance of existing...
Ngày tải lên: 10/09/2015, 08:28
Design and applications of phosphine ligands to transition metal catalyzed reactions
... development of new phosphine based chiral ligands derived from amino acids, including phosphine- amide ligands, phosphine- peptide vi ligands phosphine- olefin ligands and phosphine- imine ligands These ... DESIGN AND APPLICATIONS OF PHOSPHINE LIGANDS TO TRANSITION METAL- CATALYZED REACTIONS JIANG CHUNHUI (M.Sc., Nanjing Univ.) A THESIS SUBMITTED FOR TH...
Ngày tải lên: 09/09/2015, 09:59
Analysis and design of flexible systems to manage demand uncertainty and supply disruptions
... ANALYSIS AND DESIGN OF FLEXIBLE SYSTEMS TO MANAGE DEMAND UNCERTAINTY AND SUPPLY DISRUPTIONS GEOFFREY BRYAN ANG CHUA (M.Sci., University of the Philippines) A THESIS SUBMITTED FOR THE DEGREE OF ... Asymptotic Sale Ratio for Various Levels of Safety Capacity and Demand Uncertainty 52 2.6 Asymptotic Chaining Efficiency for Various Levels of Partial Flexibil...
Ngày tải lên: 14/09/2015, 08:39
Evaluation of different approaches to protein engineering and modulation
... 1.1.3 The three different approaches to protein engineering and modulation that were evaluated in this report In this report, three different approaches to protein engineering and modulation were ... as biotin to a protein allow it to be specifically immobilized onto an avidin-coated surface Different approaches to protein engineering and modulat...
Ngày tải lên: 05/10/2015, 22:04
Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx
... CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ... GACATCGCGCTGCTCCTTGACTGCATCACGGATCAGCTGCACTGCTTTACGATCAGTACCGCGGCC CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC CCAAAAGGCGCGCCCACCTTTTGTATAGTTTAAAACCTGTACAGT...
Ngày tải lên: 07/03/2014, 05:20
Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt
... that the phosphorylation of Tyr304 confers highaffinity and specific binding of ephrinB2(301–333) to the Grb4 SH2 domain The ephrinB2(301–333)-pY304 peptide can bind to the Grb4 SH2 and RGS3 PDZ domains ... of Grb4 binds to the cytoplasmic tail of ephrin B2 in a phosphorylation- dependent manner It is therefore interesting to know w...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... using the residual water signal as internal reference [49] Modelling the thermodynamic parameters The model used for the thermodynamic characterization of DvHc3 [13] was applied to the data obtained ... solutions In the reduced and intermediate 2257 Thermodynamic parameters in ligated proteins stages of oxidation the pH was adjusted inside the anaerobic glove box wit...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Photochemical cross-linking of Escherichia coli Fpg protein to DNA duplexes containing pdf
... conjugate and unbound DNA 1 Ó FEBS 2003 Cross-linking E coli Fpg protein to DNA duplexes (Eur J Biochem 270) 2947 Results and discussion Design of modified DNA duplexes E coli Fpg protein recognizes ... recognition and binding of DNA duplexes by the Fpg protein Specificity of Fpg protein binding The interaction between the Fpg protein and modified...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... likely mediated by activation of the MAPK pathway and that this response is substantially independent of the JAK/STAT pathway DISCUSSION Fig STAT3 and MAPK activation by Hyper-CNTF in PC12 cells ... was obtained from Amersham International (Aylesbury, UK) X-ray films (X-OMAT-AR) were from Eastman Kodak (Rochester, NJ) Cells, cytokines and antibodies PC12 and COS-7 cells (ATC...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx
... synthase, phosphofructokinase 2, ceramide synthesis, glucose uptake, apoptosis, insulin receptor substrate 1, mammalian target of rapamycin kinase (mTOR), mitogen-activated protein kinase kinase 3, ... blocked inactivation of the AMPK by insulin (Fig 7), suggesting a dominance of the fatty acid-driven pathway for activation of AMPK over at least some aspects of insulin sig...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Flexible nets The roles of intrinsic disorder in protein interaction networks potx
... number of protein protein interactions ⁄ number of complexes (inter ⁄ comp.), while the STRING search results are presented as number of protein protein interactions (inter.) only Proteins are ... contained regions of intrinsic disorder One example of an ordered hub, calmodulin, makes use of a flexible hinge to facilitate binding diversity Each of these classes and thei...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot
... useful discussions This work was partially supported by funds from the Spanish Ministry of Education (BIO2007-63458 to MP) J.B is a recipient of a predoctoral fellowship from the Spanish Ministerio ... such as bacterial stress resistance Conserved weak protein interactions in lmwPTP Comparison of lmwPTPs from phylogenetically distant species (endogenous prokaryotic and e...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... presence of unlabeled ATP, indicating that ATP and the analog 8-azido-ATP recognize the same binding site The ATPase activity of PfPDO was demonstrated The hydrolysis of ATP...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Interaction of an 40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf
... within the )148 to )124 region and only elevates transcription from the c-jun promoter by its interaction with RLjunRP occupying the element present within the )148 to )124 region of c-jun The ... is an 40 kDa protein that binds to the RLjunRP homodimer of 80 kDa giving rise to an 120 kDa DNA protein ad...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
... like a ‘C’ character All nucleobases are unstacked with respect to each other The nucleotides are in anti conformation The stereo view is from the protein surface towards DNA strand D The DNA is ... 180° rotations of their main chains at Glu36w, causing the Bc-Csp structures to open up and allowing them to re-associate as domain-swapped dimers Apart from differ...
Ngày tải lên: 23/03/2014, 09:21