The effects of ZDDP and ashless antiwear additives on the friction and wear characteristics of tribological coatings on steel
... THE EFFECTS OF ZDDP AND ASHLESS ANTIWEAR ADDITIVES ON THE FRICTION AND WEAR CHARACTERISTICS OF TRIBOLOGICAL COATINGS ON STEEL EDWARD NG SOO YONG (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE ... coatings, and antiwear additives i.e ZDDP and TPPT The discussion also includes the impact of these lubricant additives produced on the...
Ngày tải lên: 09/09/2015, 11:31
... total metal concentration increased due to the organic decomposition and therefore reduction of sludge mass The variation of DTPA extracted metals seems to be related to the changes in metal speciation ... affected by the addition of red mud Since the heavy metals have different properties and different concentrations in the red mud and compost mixtures, t...
Ngày tải lên: 23/09/2012, 14:47
... points which are mentioned: (1) The real definition of music cover and NEU’s students knowledge about the definition (2) The influence of music covers on Vietnamese music; (3) The thoughts of ... What’s music cover and how NEU’s students define it? How does music cover influence Vietnamese music? What NEU’s students think about music cover in...
Ngày tải lên: 21/04/2013, 20:53
A computational study to investigate the effects of insulation and EGR in a diesel engine
... of insulation of an IDI diesel engine The indicated power increased at the adiabatic case 30% and 22.5% in part and full loads respectively Although in the EGR applying case, performance characteristics ... also worked as a Professor and Head of department in the Department of Mechanical Engineering, Vidya Vikas Institute of Technology, Andhra Pradesh,...
Ngày tải lên: 05/09/2013, 16:11
The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention
... Investigating the effects of using bottom- up techniques in teaching listening to firstyear students; and - Formulating pedagogical implications and making suggestions for improving the teaching ... 2 The Effects of Bottom- up Techniques in Teaching Listening Skills to First Year Students at the University of Fire Fighting and...
Ngày tải lên: 07/09/2013, 13:48
The relative effects of merit pay, bonuses, and long term incenti on future job performance
... merit pay, bonuses, and long- term incentives THE RELATIVE EFFECTS OF MERIT PAY, BONUSES, AND LONG- TERM INCENTIVES ON FUTURE JOB PERFORMANCE The logic behind pay-for -performance compensation is that ... Because of the restrictions on long- term incentives, Hypothesis predicted that the effect of bonuses would be stronger than the effec...
Ngày tải lên: 11/09/2013, 11:44
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
... as a model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model ... languages department An investigation into the effects of brainstorming and giving a text as model on phan dinh phu...
Ngày tải lên: 18/12/2013, 10:08
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx
... trúc tài quan điểm Thông tin bất cân xứng cấu trúc tài Khung hoảng tài Khủng hoang tai 4/1/2009 Copyright © 2000 Addison Wesley Longman Slide #14-2 1.Cau trúc tai Cấu truc tài 2.Các quan điểm l a ... â xac đò h thơi gian Kiểm soát quản lý Slide #14-6 Các quan điểm l a chọn cấu trúc tài Một công ty tài trợ cho dự án mơi theo cac cach: cách: 1.Vay nợ 2.Huy Huy động cổ phần tư tài...
Ngày tải lên: 20/01/2014, 19:20
Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf
... addressing the reproductive and/ or developmental toxicities of these chemicals, and (d) they are of concern to the public The NTP has prepared an NTP-CERHR monograph for each phthalate This monograph ... doses of 0.1, 11, and 1,000 mg/kg, and the percentage of the oxidative derivative of the monoester and of MIDP at the same doses were, respecti...
Ngày tải lên: 13/02/2014, 10:20
Tài liệu The Effects of Education and Health on Wages and Productivity ppt
... indication of the effects of education and health on labour productivity In the case of education, it is likely that on average across the community, the effect of a person’s level of education on their ... to the effects of education (section 2.1) and health (section 2.2) on wages 2.1 Education and wages The influence of educati...
Ngày tải lên: 14/02/2014, 09:20
Tài liệu MIT Joint Program on the Science and Policy of Global Change: Effects of Air Pollution Control on Climate pdf
... to consider carefully the connections between the chemistry of the atmosphere and climate These connections are complex and their nonlinearity is exemplified by the fact that concentrations of ... consideration of control policies applied to local air pollution and global climate It also provides the capability to assess the effects of air pollution...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materi...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20