Probing heat transport in nanowires using a focused electron beam heating technique

... nanowire and relate it to the local morphology of the interface Because a focused electron beam is used as a non-contact heating source, we simply named it the electron beam heating technique ... (SThM), Raman thermography, and the thermal bridge method Chapter introduces the electron beam heating technique, starting with the working principle Electron beam – samp...

Ngày tải lên: 09/09/2015, 11:27

... instead to a less ideal source: the authors of the Wall Street Journal The problem is, of course, that authors aren't always typical A particular word might occur in a 'pattern' in which another ... p ' that the program then had to fill We compared the 'correctness' of the choices made by our program to the baseline of always choosing the most frequent synonym...

Ngày tải lên: 22/02/2014, 03:20

... blotting with anti -Cdc37 Samples were analyzed after dephosphorylation for (lanes and 7), (lanes and 8), 10 (lanes and 9), and 20 (lanes and 10) antibody against Cdc37 and the only band that became ... activate a kinase By contrast, binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kin...

Ngày tải lên: 30/03/2014, 03:20

... difference (ordinate, in bins of 0.143 ns) and the charge asymmetry (abscissa) of the signals of a same pair 34 Retaining as charge measurement the mean of the two charges of a pair and as time measurement ... a number of measurements that have been performed with the aim of gaining detailed information on the performance of the main VATLY tank and learning about impor...

Ngày tải lên: 22/07/2014, 10:19

... et al [3] stated that culturing bacteria for use in the susceptibility test transforms a biofilm forming pathogen into a planktonic lab-adapted strain Thus, the problem with the standard antibiotic ... Table 1: Mean [± standard error] zones of clearance (mm) around all the antibiotics for Gram negative bacteria [NM – Not measured Amoxycillin/ Clavulanic acid Ampicillin/ Sulbac...

Ngày tải lên: 08/08/2014, 19:20

... inflammatory RA synovium in vivo Upregulation of Fas/ FasL interaction in arthritic joints by virus vector mediated FasL gene transfer or anti -Fas antibody treatment intra-articularly can induce apoptosis ... expression of FasL protein and the frequency of apoptotic cells in RA synovium Fas protein is highly expressed in RA synovial lining cells and almost all kinds of...

Ngày tải lên: 09/08/2014, 07:20

... slaughtered at the age of 240 days (data not shown) The phenotype data of F2 animals conformed to the Gaussian distribution when age at puberty of each juvenile animal was randomly assigned in a range of ... and for 536 G Yang et al Figure The distribution of age at puberty in the F2 population of the White Duroc · Erhualian intercross avera...

Ngày tải lên: 14/08/2014, 13:21

... AGATCGTTGCACATCGGCCCAATATATAATACATATAACAACTAAACGATCAAAACGATC AGATCGTTGCACATCGGCCCAATATATAATACATATAACAACTAAACGATCAAAACGATC WT R32F3 AGCAATGAGGCTGTTTTTGCGAAGTAACTCGAC TAAACCGCGATCGCATTGT AGCAATGAGGCTGTTTTTGCGAAGTAACTCGACCGAGTAAC ... R6H8 * ATGGGCGGTGATGATGTGCAGCAGTTGTACGACGCCGGCGAGGAGGAGTTCCTCGAGATC ATGGGCGGTGATGATGTGCAGCAGTTGTACGACGCCGGCGAGGAGGAGTTCCTCGAGATC WT R6H8 ATGGCCCTGGTCGGCATGGCTTCCAAG...

Ngày tải lên: 14/08/2014, 14:21

... Cumulants of heat for product initial state for 1D linear chain113 3.6 Cumulants of heat for steady state initial state for 1D linear chain 114 3.7 The structure of a ... significant interest in the study of quantum transport But it has its origin dates back in quantum optics where the statistics of the number of photons, emitted from a source, is studied...

Ngày tải lên: 08/09/2015, 19:39

... extending above a line tangential to the supraorbital margin (horizontal line) Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn ... Unilateral absence of the frontal sinus; on the left, the absence of frontal sinus; axial view (A) , coronal view (B), and sagittal view (C) The frequency of...

Ngày tải lên: 25/10/2012, 11:04

... Int J Med Sci 2004 1(3): 137-145 138 Introduction Natural botanical products have a long history in the world and are featured in using a complex combination of herbs to treat various diseases ... daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume...

Ngày tải lên: 03/11/2012, 09:54

... involved gathering the data for use in training and testing the neural network A large training data reduces the risk of under-sampling the nonlinear function, but increases the training time ... learn the database, and to predict the properties of consolidation SELECTION OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies...

Ngày tải lên: 22/03/2013, 15:01

... not easy to create and maintain a strong brand To understand more how a company builds and manages its brand to get the full benefit from that, a study into the case of LiOA brand at Nhat Linh ... and manages its brand to get the full benefit from it, a study into the case of the LiOA brand at Nhat Linh Co., Ltd., an auto voltage sta...

Ngày tải lên: 13/04/2013, 10:29

... contaminant transport in a coupled fracture matrix system E-mail address: itsrajan2002@yahoo.co .in G Suresh Kumar is an Assistant Professor in the Department of Civil Engineering, Indian Institute of ... Refer Table for other parameters parameters Conclusion In this paper, spatial moment of analysis has been performed on colloid facilitated radionuclide conce...

Ngày tải lên: 05/09/2013, 17:03

... shape optimizations for wind turbine blades and optimization for wind- farm layouts using CFD method and genetic algorithms E-mail address: jackmin.chen@gmail.com; xc6@cec.wustl Ramesh Agarwal ... taking into account bigger size of VAWT and larger wind farms In addition, a comparative cost and power study should be performed to determine the relative economics...

Ngày tải lên: 05/09/2013, 17:03