Fabrication of cost effective and flexible polymer nanostructured substrate for bio and magnetic application

Fabrication of cost effective and flexible polymer nanostructured substrate for bio and magnetic application

Fabrication of cost effective and flexible polymer nanostructured substrate for bio and magnetic application

... Fabrication of Cost- effective and Flexible Polymer Nanostructured Substrate for Bio- and Magnetic Applications LI BIHAN B Eng (Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... Targets and Tested miRNAs 156 Appendix List of Publications 159 viii Summary This study focused on fabrication of cost- effective and flexible pol...

Ngày tải lên: 09/09/2015, 11:21

186 431 0
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

6 298 0
báo cáo hóa học:" Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART" pdf

báo cáo hóa học:" Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART" pdf

... et al.: Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART Journal of the International AIDS ... one in an urban area in Livingstone (Maramba clinic), and one in a rural part of Choma District (Pemba clinic) A third site was ur...

Ngày tải lên: 20/06/2014, 08:20

11 493 0
Báo cáo hóa học: " Fabrication of functional micro- and nanoneedle electrodes using a carbon nanotube template and electrodeposition" ppt

Báo cáo hóa học: " Fabrication of functional micro- and nanoneedle electrodes using a carbon nanotube template and electrodeposition" ppt

... nanotube nanoneedle (a) Carbon nanotube nanoneedle before Au nanoparticle coating and (b) after Au nanoparticle coating (scale bar: μm) (c) Magnified view of Au nanoparticle-coated nanoneedle (scale ... Figure Schematic diagram of the nanoneedle fabrication process (a) A carbon nanotube nanoneedle using dielectrophoresis and (b) a functional material-coat...

Ngày tải lên: 21/06/2014, 04:20

6 360 0
Fabrication of large area and precisely located nanostructures on silicon by interference lithography

Fabrication of large area and precisely located nanostructures on silicon by interference lithography

... FABRICATION OF LARGE AREA AND PRECISELY LOCATED NANOSTRUCTURES ON SILICON BY INTERFERENCE LITHOGRAPHY LIEW TZE HAW (B Eng (Hons.), University of Malaya) A THESIS SUBMITTED FOR THE DEGREE OF ... fabrication of precisely located nanostructures array on silicon by using interference lithography, in order to circumvent the limitations of conventi...

Ngày tải lên: 12/09/2015, 11:29

172 704 0
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic network...

Ngày tải lên: 07/03/2014, 15:20

18 800 0
Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx

Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx

... bound of the types of the frames being unified, (2) update one frame's type to the least upper bound, and point the other's type representation to it, and (3) recurse on respective pairs of feature ... variables to various substructures of a TFS, , and then pass those variables outside the substructures of where they can be used to instantiate the value of another...

Ngày tải lên: 08/03/2014, 07:20

8 456 0
Báo cáo khoa học: "CLASSIFICATION OF MODALITY FUNCTION AND ITS APPLICATION ANALYSIS TO JAPANESE LANGUAGE" doc

Báo cáo khoa học: "CLASSIFICATION OF MODALITY FUNCTION AND ITS APPLICATION ANALYSIS TO JAPANESE LANGUAGE" doc

... this modality analysis method to the Japanese sentence analysis in the JapaneseEnglish experimental machine translation system, LUTE.IV! 6.4 Virture of modality analysis W e show contributions of ... relationship of these three modules to the case analysis and the conjunctive analysis is shown in Fig (2) Post-case -analysis ore-case .analysis : I surface and se...

Ngày tải lên: 24/03/2014, 01:21

8 448 0
Báo cáo " Moving parabolic approximation model of point clouds and its application " pdf

Báo cáo " Moving parabolic approximation model of point clouds and its application " pdf

... our MPA approach and perform it on a number of point clouds The moving parabolic approximation model was tested on several different shapes of surface Each shape is a graph of a bivariate function ... technique [2] for modeling point- based surfaces [1] One of the main strengths of MLS projection is its ability to handle noisy data We extend the MLS technique to a...

Ngày tải lên: 28/03/2014, 10:20

7 327 0
Báo cáo hóa học: " Fabrication of Anti-human Cardiac Troponin I Immunogold Nanorods for Sensing Acute Myocardial Damage" doc

Báo cáo hóa học: " Fabrication of Anti-human Cardiac Troponin I Immunogold Nanorods for Sensing Acute Myocardial Damage" doc

... Secondly, it is also observed that this sensitivity of longitudinal band increases with higher aspect ratio (length divided by width, denoted as AR), leading to an improved detection sensitivity [17, ... conjugation is quite obscure (Fig 5c), due to the large size and nonconductibility of the antibodies Detection of h-cTnI Using Anti-h-cTnI Antibody Conjugated Gold NRs in Solution Fig S...

Ngày tải lên: 22/06/2014, 00:20

6 206 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt

Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt

... automatic generation of transform parameters meaning that the transform may automatically be adapted to the input signal or image CONCLUSION A new class of parametric transforms was investigated ... S Agaian, J Astola, and K Egiazarian, Binary Polynomial Transforms and Non-linear Digital Filters, Marcel Dekker, New York, NY, USA, 1995 [4] S S Agaian and A K Matevosia...

Ngày tải lên: 22/06/2014, 20:20

14 484 0
Báo cáo khoa học: "Analysis of the seroprevalence of bovine paratuberculosis and the application of modified absorbed ELISA to field sample testing in Korea" potx

Báo cáo khoa học: "Analysis of the seroprevalence of bovine paratuberculosis and the application of modified absorbed ELISA to field sample testing in Korea" potx

... stnemgdelwonkcA noitcefni BTP yfirev ot sdohtem rehto yb dewollof slamina laudividni rof ro dreh detcefni rof tset gnineercs a sa esoprup siht rof desu eb nac ASILE-P taht tseggus ew ,ycarucca ... sASILE owt eht rof eulav appak eht ,ASILE-P rof 001.0 fo ffotuc a gnisU stluseR ni evoba denoitnem snosaer eht rof sisylana rehtruf rof nesohc saw ASILE-P rof 001.0 fo ffotuc eht ,eroferehT tniop .....

Ngày tải lên: 07/08/2014, 18:21

6 248 0
Báo cáo y học: "Correlation of histopathological findings and magnetic resonance imaging in the spine of patients with ankylosing spondylitis" potx

Báo cáo y học: "Correlation of histopathological findings and magnetic resonance imaging in the spine of patients with ankylosing spondylitis" potx

... reported the first systematic histological study of zygapophyseal joints in patients with AS [10] In the present study, we first examined whether inflammation in the spine of patients with AS, ... and microscopic assessment of zygapophyseal joints (a) Macroscopic picture of a zygapophyseal joint from a patient with ankylosing joints spondylitis (AS) (b) Hem...

Ngày tải lên: 09/08/2014, 08:22

7 429 0
Báo cáo sinh học: " Exact p-value calculation for heterotypic clusters of regulatory motifs and its application in computational annotation of cis-regulatory modules" doc

Báo cáo sinh học: " Exact p-value calculation for heterotypic clusters of regulatory motifs and its application in computational annotation of cis-regulatory modules" doc

... confirmed individual bicoid binding sites in these sequences, these sequences not contain clusters of bicoid binding sites Assessment of gene regulation Enhancers may contain clusters of TF binding ... Individual regulatory segment of DNA can contain many binding sites for several factors, often substantially overlapping with each other [5] This brings about a problem of s...

Ngày tải lên: 12/08/2014, 17:20

15 417 0
w