Electrospun metal oxides and carbon nanofiber based materials in the application of rechargeable lithium battery
... ELECTROSPUN METAL OXIDES AND CARBON NANOFIBER- BASED MATERIALS IN THE APPLICATION OF RECHARGEABLE LITHIUM BATTERY WU YONGZHI (Bachelor of Science, Xi’an Jiaotong University, China) A THESIS ... number of electrons ● involved in stoichiometric reaction, and E0 is the standard potential of the cell with the specific reaction The type of active m...
Ngày tải lên: 09/09/2015, 11:17
... considerations The study was designed as a prospective and randomized Phase III clinical trial with a planned accrual of 45 eligible patients The APP cream and aloe vera gel were symmetrically and adjacently ... participated in the collection of data and data analyses CL and XX assisted in writing the manuscript All authors read and approved the f...
Ngày tải lên: 09/08/2014, 10:21
... image of an MWCNTs -doped SnO2 sol (c); FE-SEM image of an MWCNTs -doped SnO2 (d) Please cite this article in press as: N Van Hieu, et al., Gas- sensing properties of tin oxide doped with metal oxides ... ethanol gas and LPG Please cite this article in press as: N Van Hieu, et al., Gas- sensing properties of tin oxide doped with metal oxides an...
Ngày tải lên: 19/03/2014, 16:48
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
Human resources for industrialization and modernization associated with the development of knowledge based economy in the province of thua thien hue at the present time
... resources for industrialization and modernization associated with the development of the knowledge- based economy in the Province of Thua Thien- Hue 5 Time: Studying human resources for industrialization ... associated with the development of knowledge- based economy in the province of Thua Thien Hue Actual situati...
Ngày tải lên: 22/07/2014, 18:29
Issues and challenges in the application of micro ball bearing for silicon based microsystems
... ISSUES AND CHALLENGES IN THE APPLICATION OF MICRO- BALL BEARING FOR SILICON BASED MICROSYSTEMS ROBIN PANG SUI TING (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... of the micro- ball) and the operating conditions (RPM of the Si plate) for the groove-less ball bearings setup Thus, a micro- ball can rem...
Ngày tải lên: 08/11/2015, 17:16
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: "COMMON TOPICS AND COHERENT SITUATIONS: INTERPRETING ELLIPSIS IN THE CONTEXT OF DISCOURSE INFERENCE" ppt
... constituent in the syntax, and (2) whether the form is anaphoric in the semantics In subsequent sections, we show how the distinct mechanisms for recovering these types of missing information interact ... 203-212, Utrecht, the Netherlands, April Andrew Kehler 1993b The effect of establishing coherence in ellipsis and anaphora resolution In Pro- ceedings of t...
Ngày tải lên: 08/03/2014, 07:20
Trends of Health Education in the Developed Countries and Recommendations for Health Education in the Kingdom Of Saudi Arabia potx
... study the trends in university health education in the developed countries and recommend ambitious future trends and directions for the university health education in the Kingdom of Saudi Arabia for ... pharmacy education trends in developed countries in the fields of pharmaceutical sciences and determining special trends perta...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx
... Htt-interacting protein HIP -1 and its molecular partner HIPPI in the regulation of apoptosis and transcription, the two processes that are altered in HD [7,8] HIP -1 – its interacting partners and ... Conclusions HIP -1 and its interacting partner HIPPI together induce apoptosis by the intrinsic and extrinsic pathways Homer 1c, an interactor...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter pot
... of the rst intron of GS The nucleotide sequences of the upstream region and of the rst 1938 nucleotides of the rst intron of the rat GS gene were reported [5,6] This intron sequence ends at the ... (constructs D, I and N) These ndings demonstrated that the degree of transactivation of the GS promoter depended to a substantial degree on interactions...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo y học: "Treatment of hypertriglyceridemia and HIV: fenofibrate-induced changes in the expression of chemokine genes in circulating leukocytes" ppsx
... disturbances with the addition of fenofibrate in patients with HIV, which is accompanied by significant changes in the pattern of chemokine gene expression in circulating leukocytes The data suggest ... may be useful in the attempt to decrease the risk of atherosclerosis and may act as modulators of systemic inflammation and the associated vascular resp...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Rho kinase inhibitors Y27632 and H1152 augment neurite extension in the presence of cultured Schwann cells" pdf
... Germany) Y2 7632, is a well established inhibitor of ROCK in a variety of systems This pyridine derivative is the oldest synthesised and reported specific inhibitor of Rho -kinase family enzymes Y2 7632 ... 8.3) in the controls, 213.8 μm (SE ± 9.5) in the C3 FT group, 259.7 μm (SE ± 9.1) in the Y2 7632 group and 244.4 μm (SE ± 11.4) in the H1152 group Howev...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: " Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy" ppsx
... article as: Novins et al.: Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy Implementation ... that for the rest of the United States - substance abuse programs were transferred from the National Institute of Alcohol...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "Cigarette Smoke Exposure Alters mSin3a and Mi-2α/β Expression; implications in the control of pro-inflammatory gene transcription and glucocorticoid function" ppt
... receptors including the glucocorticoid receptor α (GRα) [10-15] HDACs function by deacetylating of key components of the transcriptional machinery including the core histone proteins resulting in their ... et al., Cigarette Smoke Exposure Alters mSin3a and Mi-2?/? Expression; implications in the control of pro-inflammatory gene transcription and gl...
Ngày tải lên: 11/08/2014, 03:20