Electrospun metal oxides and carbon nanofiber based materials in the application of rechargeable lithium battery

... ELECTROSPUN METAL OXIDES AND CARBON NANOFIBER- BASED MATERIALS IN THE APPLICATION OF RECHARGEABLE LITHIUM BATTERY WU YONGZHI (Bachelor of Science, Xi’an Jiaotong University, China) A THESIS ... number of electrons ● involved in stoichiometric reaction, and E0 is the standard potential of the cell with the specific reaction The type of active materials contained in the cell determines the ... also to helping us to better understand the practical cycling behavior of applying 1D carbonaceous nanomaterials as anode in LIB We are the first to analyze the working principle of electrospun...

Báo cáo khoa học: " A phase III trial comparing an anionic phospholipid-based cream and aloe vera-based gel in the prevention of radiation dermatitis in pediatric patients" pdf

... considerations The study was designed as a prospective and randomized Phase III clinical trial with a planned accrual of 45 eligible patients The APP cream and aloe vera gel were symmetrically and adjacently ... participated in the collection of data and data analyses CL and XX assisted in writing the manuscript All authors read and approved the final manuscript Acknowledgements Supported in part by a Cancer ... was noted by the appearance of a white residual film on the skin Aloe vera gel The aloe vera gel which was commercially available, contained water, aloe vera, D-panthenol, triethanolamine, carbomer...

gas - sensing properties of tin oxide doped with metal oxides and carbon

... image of an MWCNTs -doped SnO2 sol (c); FE-SEM image of an MWCNTs -doped SnO2 (d) Please cite this article in press as: N Van Hieu, et al., Gas- sensing properties of tin oxide doped with metal oxides ... ethanol gas and LPG Please cite this article in press as: N Van Hieu, et al., Gas- sensing properties of tin oxide doped with metal oxides and carbon nanotubes: A competitive sensor for ethanol and ... press as: N Van Hieu, et al., Gas- sensing properties of tin oxide doped with metal oxides and carbon nanotubes: A competitive sensor for ethanol and liquid petroleum gas, Sens Actuators B: Chem...

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanoparticle-based hybridization ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...

Human resources for industrialization and modernization associated with the development of knowledge based economy in the province of thua thien hue at the present time

... resources for industrialization and modernization associated with the development of the knowledge- based economy in the Province of Thua Thien- Hue 5 Time: Studying human resources for industrialization ... associated with the development of knowledge- based economy in the province of Thua Thien Hue Actual situation of training system of human resources for industrialization and modernization associated ... affecting the formation and development of human resources for industrialization and modernization associated with the development of the knowledge- based economy Natural conditions of Thua Thien Hue...

Issues and challenges in the application of micro ball bearing for silicon based microsystems

... ISSUES AND CHALLENGES IN THE APPLICATION OF MICRO- BALL BEARING FOR SILICON BASED MICROSYSTEMS ROBIN PANG SUI TING (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... of the micro- ball) and the operating conditions (RPM of the Si plate) for the groove-less ball bearings setup Thus, a micro- ball can remain at the interface due to various surface forces if the ... these microspheres for MEMS as micro ball bearings, taking into account the surface forces and the centrifugal force The model developed by Rabinovich is used to determine the critical radius of the...

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis demonstrated that a substantial amount ... transgalactooligosaccharides listed in Materials and methods Puriﬁcation and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, ...

Báo cáo khoa học: "COMMON TOPICS AND COHERENT SITUATIONS: INTERPRETING ELLIPSIS IN THE CONTEXT OF DISCOURSE INFERENCE" ppt

... constituent in the syntax, and (2) whether the form is anaphoric in the semantics In subsequent sections, we show how the distinct mechanisms for recovering these types of missing information interact ... 203-212, Utrecht, the Netherlands, April Andrew Kehler 1993b The effect of establishing coherence in ellipsis and anaphora resolution In Pro- ceedings of the 31st Conference of the Association ... way of their corresponding node(s) in the syntax; the operations performed on these representations are dictated by the nature of the constraints imposed The two types of inference are distinguished...

Trends of Health Education in the Developed Countries and Recommendations for Health Education in the Kingdom Of Saudi Arabia potx

... study the trends in university health education in the developed countries and recommend ambitious future trends and directions for the university health education in the Kingdom of Saudi Arabia for ... pharmacy education trends in developed countries in the fields of pharmaceutical sciences and determining special trends pertaining to pharmacy education in the Kingdom of Saudi Arabia based on the ... when selecting international experiences for analysis aiming to find the most suitable ideas and solutions for the case of the Kingdom of Saudi Arabia The representative of each one of the five...

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... Htt-interacting protein HIP -1 and its molecular partner HIPPI in the regulation of apoptosis and transcription, the two processes that are altered in HD [7,8] HIP -1 – its interacting partners and ... Conclusions HIP -1 and its interacting partner HIPPI together induce apoptosis by the intrinsic and extrinsic pathways Homer 1c, an interactor of HIPPI, and the wild-type N-terminal Htt, which interacts ... apoptosis induction The effect of HIP -1 may depend not only on the amount of the interacting proteins but also on the afﬁnities of interacting proteins The uncreased expression of caspase -1 observed in...

Báo cáo khoa học: Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter pot

... of the rst intron of GS The nucleotide sequences of the upstream region and of the rst 1938 nucleotides of the rst intron of the rat GS gene were reported [5,6] This intron sequence ends at the ... (constructs D, I and N) These ndings demonstrated that the degree of transactivation of the GS promoter depended to a substantial degree on interactions between the upstream and intron regulatory sequences ... effective transactivation of the GS promoter Other intriguing ndings were that the upstream enhancer lost most of its activity when present in the context of the entire upstream region in muscle cells,...

Báo cáo y học: "Treatment of hypertriglyceridemia and HIV: fenofibrate-induced changes in the expression of chemokine genes in circulating leukocytes" ppsx

... disturbances with the addition of fenofibrate in patients with HIV, which is accompanied by significant changes in the pattern of chemokine gene expression in circulating leukocytes The data suggest ... may be useful in the attempt to decrease the risk of atherosclerosis and may act as modulators of systemic inflammation and the associated vascular response However, further studies in other type ... for the study CA-V wrote the first draft of the manuscript JJ, JC and JMA contributed to the final version of the manuscript GA, RB-D and AR helped in the data analysis and interpretation JJ and...

Báo cáo y học: "Rho kinase inhibitors Y27632 and H1152 augment neurite extension in the presence of cultured Schwann cells" pdf

... Germany) Y2 7632, is a well established inhibitor of ROCK in a variety of systems This pyridine derivative is the oldest synthesised and reported specific inhibitor of Rho -kinase family enzymes Y2 7632 ... 8.3) in the controls, 213.8 μm (SE ± 9.5) in the C3 FT group, 259.7 μm (SE ± 9.1) in the Y2 7632 group and 244.4 μm (SE ± 11.4) in the H1152 group However, only the neurite lengths in the Y2 7632 and ... fusion toxin and the ROCK inhibitors Y2 7632 and H1152 showed an increase in the average length of their longest neurites when compared to the control group (medium only) The average maximal neurite...

báo cáo khoa học: " Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy" ppsx

... article as: Novins et al.: Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy Implementation ... that for the rest of the United States - substance abuse programs were transferred from the National Institute of Alcohol Abuse and Alcoholism to the IHS in 1978 [59], and the training of counselors ... improve the quality of services for AI/ANs with substance use problems The initiatives to increase the use of EBTs in substance abuse programs have certainly grown out of a strong, nationwide and...

Báo cáo y học: "Cigarette Smoke Exposure Alters mSin3a and Mi-2α/β Expression; implications in the control of pro-inflammatory gene transcription and glucocorticoid function" ppt

... receptors including the glucocorticoid receptor α (GRα) [10-15] HDACs function by deacetylating of key components of the transcriptional machinery including the core histone proteins resulting in their ... et al., Cigarette Smoke Exposure Alters mSin3a and Mi-2?/? Expression; implications in the control of pro-inflammatory gene transcription and glucocorticoid function Journal of Inflammation 2010, ... reduction in the protein expression of Mi-2α and mSin3a and increased protein expression of Mi2β may lead to altered gene repression This in turn may have important implications in the development of...

Xem thêm

Từ khóa: choosing business strategy and solutions to apply strategy for pvv investment and construction materials in the period of 2013 2017 drawing materials in the work of alle hosper tried and true tactics are valued in the allocation of budgets and non melanoma skin cancer in the inhabitants of the upper silesia poland patient s antimicrobial immunity and etiopathogens during picis formation in the course of disease progression decades product labeling has become a popular policy tool particularly with respect to the provision of nutrition and health information it culminated in the passage of the nutritional labeling and education act nlea in 1990 and 13c filtered noesy and tocsy to monitor changes in the conformation of the ligand upon interactions evidence based medicine in the treatment of femoroacetabular impingement role of gangliosides and plasma membrane associated sialidase in the process of cell membrane organization factors affecting the durability of reinforced concrete and cement based materials used in the construction of swimming pools supported metal oxides and the surface density metric polymethylsilane and pcs promising precursors for sic based materials via the polymer blend technique extend role based management to the management of change and configuration business less the costs necessary to make the sale and in the case of raw materials and work in progress the estimated costs to complete the production construction or manufacture business those under production and materials or supplies to be used in the production process or in the rendering of services Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ