Development of bismuth based visible light driven photocatalysts for the degradation of organic pollutants

... where χ is the electronegativity of the semiconductor which is taken as the geometric mean of the electronegativities of the component elements of the semiconductor, Ee is the energy of the free ... XII Summary Organic pollutants becomes a pervasive threat with the step forward of human beings Photocatalysis is an effective method for the degradation o...

Ngày tải lên: 09/09/2015, 11:16

... consists of two co-axial cylinders When the inner cylinder is rotated at a certain speed, the unsteady flow within the annulus allows the fluids to recirculate from the vicinity of the rotating inner ... toxic organic pollutants In addition, the increasing population of the world is also escalating the requirements of pure water for drinking and household pur...

Ngày tải lên: 14/09/2015, 12:35

... better visible light absorbance, although unfortunately this has not always lead to better water oxidation performance and photocatalytic activity.13,22 However, it is clear that by using a water oxidation ... N-modified TiO2 films Water Oxidation Catalyst for N-Modified TiO2 Nanowire Films In PEC water splitting, the water oxidation half reaction is normally more challe...

Ngày tải lên: 18/09/2013, 21:26

... THE DEVELOPMENT AND STUDY OF TITANIUM DIOXIDE BASED BUOYANT COMPOSITE PHOTOCATALYSTS FOR IMPROVED APPLICATIONS IN PHOTOCATALYTIC DEGRADATION OF ORGANIC POLLUTANTS IN AQUEOUS SOLUTIONS ... provide some preliminary information about the combination of the buoyant composite photocatalyst with an adsorbent component and the performance of...

Ngày tải lên: 10/09/2015, 15:50

... In the docking literature one often finds the distinction between ‘bound’ and ‘unbound’ docking: the former refers to docking using the structures of the single proteins as they are present in the ... assessment of which residues of the labeled molecule are perturbed by the formation of the complex One then repeats this procedure with the second molecule labele...

Ngày tải lên: 30/03/2014, 15:20

... The Tien Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine CONTENT OF THESIS ... Nguyen The Tien 18 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal ox...

Ngày tải lên: 12/05/2014, 17:14

... (2) image fusion using the mixed IMFs of panchromatic and MS images; and (3) quality assessment of the fused image The test data include SPOT images of a forest area and QuickBird images of a ... are the gray value of the fused and MS images, respectively μF is the mean of fused image, μM is the mean of MS image, and m and n are the image...

Ngày tải lên: 20/06/2014, 20:20

... goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32 Virology Journal 2010 7:245 Authors’ details Key Laboratory of Animal Virology of Ministry of Agriculture, ... in the sequence alignment and drafted the manuscript YC and JW carried out the MNT and established indirect ELISA YS participated in the...

Ngày tải lên: 12/08/2014, 01:22

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...

Ngày tải lên: 14/08/2014, 16:21

... reinforcement phase, or both in the composites Sol gel composites comprise inorganic- inorganic composites and organic- inorganic composites By doping ceramic reinforcement phase in inorganic sol gel ... DEVELOPMENT OF ORGANIC/ INORGANIC COMPOSITES BY SOL GEL METHOD FOR TOOLING MATERIALS LIU FENGMIN (B Eng., Beijing University of Aeronautics &...

Ngày tải lên: 04/10/2015, 15:57

... http://www.springeronline.com For information on translations, please e-mail info @apress. com, or visit http://www .apress. com Apress and friends of ED books may be purchased in bulk for academic, corporate, ... titles For more information, reference our Special Bulk Sales–eBook Licensing web page at http://www .apress. com/info/bulksales The information in this book is distributed on an...

Ngày tải lên: 06/08/2013, 17:29

... carbon storage is one of the important processes for the DOC removal in activated sludge CONCLUSIONS The occurrence of temporal carbon storage material, PHA, was confirmed in the course of wastewater ... calculated as the amount of PHA increased during the anaerobic phase divided by the amount of carbon supplied as influent in one cycle...

Ngày tải lên: 05/09/2013, 09:38

... a method of quantifying variability and uncertainty in risk A tiered approach to PRA is recommended for Superfund sites, beginning with a point-estimate analysis or deterministic risk assessment, ... data used in the model, the more representative the model output can be of land application at field scales The intent of introducing this approach is to encourage all involve...

Ngày tải lên: 14/02/2014, 03:20