Natural convection mass transfer hydromagnetic flow past an oscillating porous plate with heat source in a porous medium
... flow and heat transfer along a vertical porous plate with variable suction and internal heat generation Das and his associates [16] studied the mass transfer effects on MHD flow and heat transfer ... a porous medium with suction and heat source Natural convection unsteady magnetohydrodynamic mass transfer flow past an infinite vertical poro...
Ngày tải lên: 09/09/2015, 10:32
... free convection flow past an infinite vertical plate with constant suction and mass transfer Int J Heat Mass Trans.1977, 20, 1363-1373 [5] Hossain M A., Begum R A Effect of mass transfer and free ... convection mass transfer flow of a viscous incompressible electrically conducting fluid past an infinite vertical porous plate in presen...
Ngày tải lên: 05/09/2013, 15:28
... Reinhart K: Plasma concentrations and clearance of procalcitonin during continuous veno-venous hemofiltration in septic patients Shock 2001, 15:171-175 Dahaba A, Elawady G, Rehak P, List W: Procalcitonin ... *** PCT J4 Procalcitonin (PCT) plasma concentration and clearance kinetics during continuous venovenous hemofiltration (CVVH) (a) PCT ultrafilt...
Ngày tải lên: 12/08/2014, 19:22
Performance analysis of an endoreversible rectangular cycle with heat transfer loss and variable specific heats of working fluid
... rectangular cycle with heat transfer loss and variable specific heats of working fluid Cycle model An air standard rectangular cycle is shown in Figure The heat additions are an isochoric process 1-2 and ... rectangular cycle with heat transfer loss and studied the performance characteristics of the cycle Liu et al [26] modeled irrev...
Ngày tải lên: 09/09/2015, 10:17
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx
... to the evolution of the temperature instead of the heat flux at x = The problem (P6) can be considered a non-classical moving boundary problem for the heat equation as a generalization of the ... Argentina 3Depto de Matemática, Universidad Austral, Paraguay 1950, S2000FZF Rosario, Argentina 4Facultad de Ingenier a, Universidad Nacional de Salta, Buenos Aires 144,...
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: " An Approach to Optimum Joint Beamforming Design in a MIMO-OFDM Multiuser System" potx
... is an Assistant Professor at UPC, Barcelona, Spain Currently, he is involved in several national and European research projects Joint Beamforming Design in a MIMO-OFDM Multiuser System Ana I ... converge to any acceptable design The SA algorithm has analogies with the annealing of solids in physics and thermodynamics, as has been explained in [8] The main objective o...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo y học: "Fibrolipomatous hamartoma in the median nerve in the arm - an unusual location but with MR imaging characteristics: a case report" pps
... clinicopathologic analysis of 26 cases Am J Surg Pathol 1985, 9: 7-1 4 Cavallaro MC, Taylor JA, Gorman JD, Haghighi P, Resnick D: Imaging findings in a patient with fibrolipomatous hamartoma of the median nerve ... hamartoma of the median nerve An incisional biopsy after exploration of the median nerve was done in February 2009 under microscopical dissectio...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Spondylarthritis presenting with an allergic immediate systemic reaction to adalimumab in a woman: a case report" pptx
... X-ray and a magnetic resonance imaging scan showed sacroiliitis A diagnosis of spondylarthritis was made The patient was started on therapy with sulfasalazine g/day and deflazacort 7.5 mg/day ... Phadia, Uppsala, Sweden in collaboration with our Laboratory of Immunology and Allergy, was used to assay serumspecific IgE to adalimumab A commercial Phadia ImmunoCAP was used for...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report" pptx
... doi:10.1186/1752-1947-5-184 Cite this article as: Theodorou et al.: Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report Journal of Medical Case Reports 2011 ... neurofibroma, nerve sheath myxoma or neurothekeoma, synovial sarcoma, aggressive angiomyxoma, dermoid and epidermoid cyst, lipoma, neuroma and gan...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Successful desensitization with human insulin in a patient with an insulin allergy and hypersensitivity to protamine: a case report" pptx
... human insulin (56 U/ml; normal value,
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx
... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p-env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmE...
Ngày tải lên: 13/08/2014, 01:20
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium
... Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass transfer effects on MHD flow and heat transfer past a vertical porous plate through a porous medium ... 927-941 [9] Sattar M A Free convection and mass transfer flow through a porous medium past an infinite vertical porous plate with time depend...
Ngày tải lên: 05/09/2013, 14:58
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han ... studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with ribs on the heated wall in transverse, inclined, V-continu...
Ngày tải lên: 05/09/2013, 16:10
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source
... transfer to unsteady magneto-hydrodynamic flow past an infinite vertical moving plate with variable suction Das and his co-workers [16] estimated the mass transfer effects on unsteady flow past ... the variation of the flow parameters such as Prandtl number Pr, magnetic parameter M, permeability parameter Kp and heat source parameter S The variations in the temperatu...
Ngày tải lên: 05/09/2013, 16:10
Báo cáo hóa học: " Boundary layer flow past a stretching/shrinking surface beneath an external uniform shear flow with a convective surface boundary condition in a nanofluid" pptx
... Magyari and Weidman [41] to a stretching/shrinking surface with a convective boundary condition immersed in a nanofluid, that is, to study the steady boundary layer shear flow over a stretching/shrinking ... stretching/shrinking surface beneath an external uniform shear flow with a convective surface boundary condition in a nanof...
Ngày tải lên: 21/06/2014, 04:20